Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU130861

Sigma-Aldrich

MISSION® esiRNA

targeting human LRWD1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCTGTCAGGATTGGAGCTGCTTTCCGAGCACCTGGACCCCAAACTCCTGTGCCGCCTGACGCAGCTGCAGGAGCTTGACCTGTCTAACAACCACCTGGAGACGCTGCCGGACAACCTGGGCCTGTCCCACCTGCGTGTCCTCCGCTGCGCCAACAACCAGCTGGGGGATGTTACTGCCTTGTGCCAGTTCCCCAAGCTCGAGGAACTCAGCCTGGAGGGCAACCCCTTCCTGACGGTCAATGACAACCTGAAAGTCTCCTTTCTCCTGCCCACGCTCCGTAAGGTCAATGGCAAGGATGCGTCCTCAACTTACTCTCAGGTGGAGAACCTGAATCGGGAGCTGACCAGCAGGGTCACAGCTCACTGGGAGAAGTTCATGGCCACACTGGGTCCTGAAGAGGAGGCTGAGAAGGCCCAGGCGGACTTTGTGAAGTCGGCTGTCAGGGATGTCCGCTACGGGCCCGAGTCCCTCAGCGAGTTCAC

Ensembl | nº de acceso humano

ENSG00000161036

Nº de acceso NCBI

NM_152892

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... LRWD1(222229) , LRWD1(222229)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Julien Brustel et al.
The EMBO journal, 36(18), 2726-2741 (2017-08-06)
Among other targets, the protein lysine methyltransferase PR-Set7 induces histone H4 lysine 20 monomethylation (H4K20me1), which is the substrate for further methylation by the Suv4-20h methyltransferase. Although these enzymes have been implicated in control of replication origins, the specific contribution
Satish Sati et al.
Molecular cell, 78(3), 522-538 (2020-03-30)
To understand the role of the extensive senescence-associated 3D genome reorganization, we generated genome-wide chromatin interaction maps, epigenome, replication-timing, whole-genome bisulfite sequencing, and gene expression profiles from cells entering replicative senescence (RS) or upon oncogene-induced senescence (OIS). We identify senescence-associated heterochromatin

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico