Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU129201

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA1B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCGAGAAGGACGAGTTTGAGCACAAGAGGAAGGAGCTGGAGCAGGTGTGTAACCCCATCATCAGCGGACTGTACCAGGGTGCCGGTGGTCCCGGGCCTGGCGGCTTCGGGGCTCAGGGTCCCAAGGGAGGGTCTGGGTCAGGCCCTACCATTGAGGAGGTGGATTAGGGGCCTTTGTTCTTTAGTATGTTTGTCTTTGAGGTGGACTGTTGGGACTCAAGGACTTTGCTGCTGTTTTCCTATGTCATTTCTGCTTCAGCTCTTTGCTGCTTCACTTCTTTGTAAAGTTGTAACCTGATGGTAATTAGCTGGCTTCATTATTTTTGTAGTACAACCGATATGTTCATTAGAATTCTTTGCATTTAATGTTGATACTGTAAGGGTGTTTCGTTCCCTTTAAATGAATCAACACTGCCACCTTCTGTACGA

Ensembl | nº de acceso humano

ENSG00000204388

Nº de acceso NCBI

NM_005346

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HSPA1B(3304) , HSPA1B(3304)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dmitry Kondrikov et al.
PloS one, 10(6), e0129343-e0129343 (2015-06-13)
Exposure of pulmonary artery endothelial cells (PAECs) to hyperoxia results in a compromise in endothelial monolayer integrity, an increase in caspase-3 activity, and nuclear translocation of apoptosis-inducing factor (AIF), a marker of caspase-independent apoptosis. In an endeavor to identify proteins
Alessandro Vanoli et al.
Histochemistry and cell biology, 144(2), 179-184 (2015-05-09)
Ubiquitin-proteasome system (UPS) proteins and proteolytic activity are localized in a recently identified cytoplasmic structure characterized by accumulation of barrel-like particles, which is known as the particulate cytoplasmic structure (PaCS). PaCSs have been detected in neoplastic, preneoplastic, chronically infected, and
Sujatha Muralidharan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(4), 1975-1987 (2014-07-16)
Binge or moderate alcohol exposure impairs host defense and increases susceptibility to infection because of compromised innate immune responses. However, there is a lack of consensus on the molecular mechanism by which alcohol mediates this immunosuppression. In this study, we

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico