Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU127961

Sigma-Aldrich

MISSION® esiRNA

targeting human NCF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCAGCCAGCACTATGTGTACATGTTCCTGGTGAAATGGCAGGACCTGTCGGAGAAGGTGGTCTACCGGCGCTTCACCGAGATCTACGAGTTCCATAAAACCTTAAAAGAAATGTTCCCTATTGAGGCAGGGGCGATCAATCCAGAGAACAGGATCATCCCCCACCTCCCAGCTCCCAAGTGGTTTGACGGGCAGCGGGCCGCCGAGAACCGCCAGGGCACACTTACCGAGTACTGCGGCACGCTCATGAGCCTGCCCACCAAGATCTCCCGCTGTCCCCACCTCCTCGACTTCTTCAAGGTGCGCCCTGATGACCTCAAGCTCCCCACGGACAACCAGACAAAAAAGCCAGAGACATACTTGATGCCCAAAGATGGCAAGAGTACCGCGACAGACATCA

Ensembl | nº de acceso humano

ENSG00000158517

Nº de acceso NCBI

NM_000265

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NCF1(653361) , NCF1(653361)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
IVR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bharatwaj Sowrirajan et al.
Scientific reports, 7, 43441-43441 (2017-02-28)
Interleukin (IL)-27, a member of the IL-12 cytokine family, plays an important and diverse role in the function of the immune system. We have previously demonstrated that IL-27 is an anti-viral cytokine which inhibits HIV-1, HIV-2, Influenza virus and herpes
Tian Wang et al.
Biochemical and biophysical research communications, 489(4), 361-368 (2017-05-10)
In acute lung injury/acute respiratory distress syndrome (ALI/ARDS), pathogenesis is associated with the regulation of macrophage-generated oxidative stress, and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-derived reactive oxygen species(ROS) are key to regulating oxidative stress. In the present study, we
Dehong Yan et al.
The Journal of experimental medicine, 217(2) (2019-10-31)
Myeloid-derived suppressor cells (MDSCs) are "polarized" myeloid cells that effectively promote tumorigenesis by inhibiting antitumor immunity. How myeloid cells acquire the protumoral properties during tumorigenesis is poorly understood. We report here that the polarity protein TIPE2 (tumor necrosis factor-α-induced protein
Matthew R DiStasi et al.
American journal of physiology. Heart and circulatory physiology, 306(10), H1435-H1443 (2014-03-19)
The role of NADPH oxidase (Nox) in both the promotion and impairment of compensatory collateral growth remains controversial because the specific Nox and reactive oxygen species involved are unclear. The aim of this study was to identify the primary Nox

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico