Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU127561

Sigma-Aldrich

MISSION® esiRNA

targeting human GDF5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAGGACGATAAGACCGTGTATGAGTACCTGTTCAGCCAGCGGCGAAAACGGCGGGCCCCACTGGCCACTCGCCAGGGCAAGCGACCCAGCAAGAACCTTAAGGCTCGCTGCAGTCGGAAGGCACTGCATGTCAACTTCAAGGACATGGGCTGGGACGACTGGATCATCGCACCCCTTGAGTACGAGGCTTTCCACTGCGAGGGGCTGTGCGAGTTCCCATTGCGCTCCCACCTGGAGCCCACGAATCATGCAGTCATCCAGACCCTGATGAACTCCATGGACCCCGAGTCCACACCACCCACCTGCTGTGTGCCCACGCGGCTGAGTCCCATCAGCATCCTCTTCATTGACTCTGCCAACAACGTGGTGTATAAGCAGTATGAGGACATGGTCGTGGAGTCGTGTGGCTGCAGGTAGCAGCACTGGCCCTCTGTCTTCCTGGGTGGCACATCCCAAGAGCCCCTTCCTGCACTCCTGGAATCACAGAGGGGTCAGGAAGCTGTGGCAGGAGCATCTACA

Ensembl | nº de acceso humano

ENSG00000125965

Nº de acceso NCBI

NM_000557

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GDF5(8200) , GDF5(8200)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Md Fahmid Islam et al.
Scientific reports, 7(1), 1040-1040 (2017-04-23)
Next generation sequencing is becoming the method of choice for functional genomic studies that use pooled shRNA or CRISPR libraries. A key challenge in sequencing these mixed-oligo libraries is that they are highly susceptible to hairpin and/or heteroduplex formation. This
Wei Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1414-1421 (2016-10-25)
The precise role of interleukin-1 beta (IL-1β)-induced extracellular matrix degeneration in the pathogenesis of intervertebral disc degeneration (IDD) is currently unknown. Recent evidence has revealed that microRNAs (miRNAs) are associated with IDD, but their function in the extracellular matrix degradation
Dagmara M Wiatrek et al.
RNA (New York, N.Y.), 25(6), 713-726 (2019-03-22)
Viral and cellular double-stranded RNA (dsRNA) is recognized by cytosolic innate immune sensors, including RIG-I-like receptors. Some cytoplasmic dsRNA is commonly present in cells, and one source is mitochondrial dsRNA, which results from bidirectional transcription of mitochondrial DNA (mtDNA). Here

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico