Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU125411

Sigma-Aldrich

MISSION® esiRNA

targeting human CACNA1C (2)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAAGGCATGGATGAGGAGAAGCCCCGAAACAGAGGCACTCCGGCGGGCATGCTTGATCAGAAGAAAGGGAAGTTTGCTTGGTTTAGTCACTCCACAGAAACCCATGTGAGCATGCCCACCAGTGAGACCGAGTCCGTCAACACCGAAAACGTGGCTGGAGGTGACATCGAGGGAGAAAACTGCGGGGCCAGGCTGGCCCACCGGATCTCCAAGTCAAAGTTCAGCCGCTACTGGCGCCGGTGGAATCGGTTCTGCAGAAGGAAGTGCCGCGCCGCAGTCAAGTCTAATGTCTTCTACTGGCTGGTGATT

Ensembl | nº de acceso humano

ENSG00000151067

Nº de acceso NCBI

NM_000719

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CACNA1C(775) , CACNA1C(775)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hoe-Su Jeong et al.
Biochimica et biophysica acta, 1849(6), 709-721 (2015-03-01)
The ubiquitin-proteasome system (UPS) plays an important role in protein quality control, cellular signalings, and cell differentiation through the regulated turnover of key transcription factors in cardiac tissue. However, the molecular mechanism underlying Fbxo25-mediated ubiquitination of cardiac transcription factors remains
Dan Yang et al.
Cancer chemotherapy and pharmacology, 76(3), 575-586 (2015-07-26)
5-Fluorouracil (5-FU) is the basic chemotherapeutic agent used to treat colon cancer. However, the sensitivity of colon cancer cells to 5-FU is limited. Gossypol is a polyphenolic extract of cottonseeds. The purpose of this study was to investigate the activities
F Wang et al.
Acta physiologica (Oxford, England), 214(2), 261-274 (2015-04-08)
The primary aim of this study was to identify the effects of hyperammonaemia on functional expression of Cav1.2 L-type Ca(2+) channels in astroglia. Primary cultures of mouse astrocytes were used to study effects of chronic treatment (1-5 days) with ammonium

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico