Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU123971

Sigma-Aldrich

MISSION® esiRNA

targeting human MOK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGCACCCCTACTTCCAAGAACAGAGGAAAACAGAGAAGCGGGCTCTGGGCAGCCACAGAAAAGCTGGCTTTCCGGAGCACCCTGTGGCACCGGAACCACTCAGTAACAGCTGCCAGATTTCCAAGGAGGGCAGAAAGCAGAAACAGTCCCTAAAGCAAGAGGAGGACCGTCCCAAGAGACGAGGACCGGCCTATGTCATGGAACTGCCCAAACTAAAGCTTTCGGGAGTGGTCAGACTGTCGTCTTACTCCAGCCCCACGCTGCAGTCCGTGCTTGGATCTGGAACAAATGGAAGAGTGCCGGTGCTGAGACCCTTGAAGTGCATCCCTGCGAGCAAGAAGACAGATCCGCAGAAGGACCTTAAGCCTGCCCCGCAGCAGTGTCGCCTGCCCACCATAGTGCGGAAAGGCGGAAGATAACTGAGCAGCACCG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenbin Ye et al.
Apoptosis : an international journal on programmed cell death, 22(1), 86-97 (2016-11-20)
This study aimed to investigate the effect of AOPPs on apoptosis in human chondrocytes. Chondrocytes were treated with AOPPs. Cell death, nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activity, reactive oxygen species (ROS) generation, and the expression of apoptotic proteins were
Bikesh K Nirala et al.
Diabetes & vascular disease research, 12(4), 290-297 (2015-05-13)
Pro-inflammatory conditions induced by products of protein glycation in diabetes substantially enhance the risk of endothelial dysfunction and related vascular complications. Endothelial cell specific molecule-1 (ESM-1) or endocan has been demonstrated as a potential biomarker in cancer and sepsis. Its
Yosuke Kanno et al.
Arthritis research & therapy, 22(1), 76-76 (2020-04-11)
Fibrotic diseases are characterized by tissue overgrowth, hardening, and/or scarring because of the excessive production, deposition, and contraction of the extracellular matrix (ECM). However, the detailed mechanisms underlying these disorders remain unclear. It was recently reported that α2-antiplasmin (α2AP) is
Yan Xia Yu et al.
American journal of translational research, 9(6), 2760-2774 (2017-07-04)
Non-small cell lung cancer (NSCLC) constitutes the main cases of lung cancer and is the world's most common and lethal cancer owing to regional invasion or distant metastasis. Growing morbidity and lethality demonstrates that valid molecular target in management of
Jing Zhou et al.
BioMed research international, 2018, 1650456-1650456 (2018-11-08)
Intermittent hypoxia (IH) that resulted from obstructive sleep apnea (OSA) has been found to be a risk factor of coronary artery disease. IH and the receptor for advanced glycation end products (RAGE) expression are known to activate monocyte/macrophage and associated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico