Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU123061

Sigma-Aldrich

MISSION® esiRNA

targeting human AFDN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCTGGGCCTGAGCTGATACTACCTGCAAGCATTGAATTCAGGGAAAGTTCTGAAGATTCATTTTTGTCTGCCATTATAAATTATACTAATAGCTCTACAGTCCACTTTAAGTTGTCCCCTACATATGTATTATATATGGCATGCCGGTATGTATTGTCCAACCAGTACAGACCTGACATCAGCCCTACAGAGCGCACACATAAAGTCATTGCAGTCGTCAACAAGATGGTGAGCATGATGGAGGGTGTCATCCAGAAACAGAAGAATATTGCAGGGGCACTTGCCTTCTGGATGGCAAATGCATCTGAACTTCTCAACTTCATTAAGCAAGACCGAGACCTTAGTCGGATCACACTGGATGCTCAAGATGTTTTAGCACATTTGGTTCAAATGGCATTTAAATACTTGGTTCACTGTCTTCAATCAGAACTTAATAATTACATGCCAGCCTTTCTAGATG

Ensembl | nº de acceso humano

ENSG00000130396

Nº de acceso NCBI

NM_001040000

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... AFDN(4301) , MLLT4(4301)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Paul Ugalde-Silva et al.
MicrobiologyOpen, 8(12), e931-e931 (2019-10-01)
Enteropathogenic Escherichia coli (EPEC) infection causes a histopathological lesion including recruitment of F-actin beneath the attached bacteria and formation of actin-rich pedestal-like structures. Another important target of EPEC is the tight junction (TJ), and EspF induces displacement of TJ proteins
Haruko Tsurumi et al.
Laboratory investigation; a journal of technical methods and pathology, 96(1), 49-59 (2015-11-17)
In kidney glomeruli, mesangial cells provide structural support to counteract for expansile forces caused by pressure gradients and to regulate the blood flow. Glomerular injury results in proliferation and aberrant migration of mesangial cells, which is the pathological characteristic of
Takuro Yamamoto et al.
BMC cancer, 15, 275-275 (2015-04-17)
AF-6/afadin plays an important role in the formation of adherence junctions. In breast and colon cancer, loss of AF-6/afadin induces cell migration and cell invasion. We aimed to elucidate the role of AF-6/afadin in human endometrial cancer. Morphology and AF-6/afadin

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico