Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU122491

Sigma-Aldrich

MISSION® esiRNA

targeting human FABP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTTTCTCCGGCAAGTACCAACTGCAGAGCCAGGAAAACTTTGAAGCCTTCATGAAGGCAATCGGTCTGCCGGAAGAGCTCATCCAGAAGGGGAAGGATATCAAGGGGGTGTCGGAAATCGTGCAGAATGGGAAGCACTTCAAGTTCACCATCACCGCTGGGTCCAAAGTGATCCAAAACGAATTCACGGTGGGGGAGGAATGTGAGCTGGAGACAATGACAGGGGAGAAAGTCAAGACAGTGGTTCAGTTGGAAGGTGACAATAAACTGGTGACAACTTTCAAAAACATCAAGTCTGTGACCGAACTCAACGGCGACATAATCACCAATACCATGACATTGGGTGACATT

Ensembl | nº de acceso humano

ENSG00000163586

Nº de acceso NCBI

NM_001443

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FABP1(2168) , FABP1(2168)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yujuan Wang et al.
PloS one, 14(4), e0214144-e0214144 (2019-04-23)
Castration is an important means of improving the beef quality via increasing fat deposition. However, little is known about the molecular mechanism underlying the fat deposition after castration. Here, the intramuscular fat (IMF) content of the steer group was shown
Yufei Chen et al.
Journal of pharmacy & pharmaceutical sciences : a publication of the Canadian Society for Pharmaceutical Sciences, Societe canadienne des sciences pharmaceutiques, 20(0), 239-251 (2017-08-16)
To investigate the effect of clofibrate on inducing liver fatty acid binding protein (FABP1) following a high-fat load in a hepatocyte cell culture model. Rat hepatoma cells (CRL-1548) were treated with a fatty acid (FA) mixture consisting of oleate:palmitate (2:1)
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico