Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU122041

Sigma-Aldrich

MISSION® esiRNA

targeting human MCAM

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGAGGAAGGTGTGGGTGAAAGAGAATATGGTGTTGAATCTGTCTTGTGAAGCGTCAGGGCACCCCCGGCCCACCATCTCCTGGAACGTCAACGGCACGGCAAGTGAACAAGACCAAGATCCACAGCGAGTCCTGAGCACCCTGAATGTCCTCGTGACCCCGGAGCTGTTGGAGACAGGTGTTGAATGCACGGCCTCCAACGACCTGGGCAAAAACACCAGCATCCTCTTCCTGGAGCTGGTCAATTTAACCACCCTCACACCAGACTCCAACACAACCACTGGCCTCAGCACTTCCACTGCCAGTCCTCATACCAGAGCCAACAGCACCTCCACAGAGAGAAAGCTGCCGGAGCCGGAGAGCCGGGGCGTGGTCATCGTGGCTGTGATTGTGTGCATCCT

Ensembl | nº de acceso humano

ENSG00000076706

Nº de acceso NCBI

NM_006500

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MCAM(4162) , MCAM(4162)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Connor Stevenson et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 66(8), 691-700 (2017-04-30)
To evaluate the effects of MUC18 on IL-13-mediated airway inflammatory responses in human airway epithelial cells and in mice. Primary normal human tracheobronchial epithelial (HTBE) cells, wild-type (WT) and Muc18 knockout (KO) mice, and mouse tracheal epithelial cells (mTECs) were
Toshio Yawata et al.
Journal of neuro-oncology, 144(1), 21-32 (2019-05-31)
CD146 is highly expressed in various malignant tumors and contributes to their malignancy phenotype, which involves metastatic and tumorigenic activity. However, studies on the expression and function of CD146 in brain tumors are limited. We over-expressed or knocked-down CD146 in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico