Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU121691

Sigma-Aldrich

MISSION® esiRNA

targeting human ATAD2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGAAACCTACCACCGGACACGTGCTTTAAGATCTTTGAGAAAAGATGCACAGAATTCTTCAGATTCTAGTTTTGAGAAGAATGTGGAAATAACGGAGCAACTTGCTAATGGCAGGCATTTTACAAGGCAGTTGGCCAGACAGCAGGCTGATAAAAAAAAAGAAGAGCACAGAGAAGACAAAGTGATTCCAGTTACTCGGTCATTGAGGGCTAGAAACATCGTTCAAAGTACAGAACACTTACATGAAGATAATGGTGATGTTGAAGTGCGTCGAAGTTGTAGGATTAGAAGTCGTTATAGTGGTGTAAACCAGTCCATGCTGTTTGACAAACTTATAACTAACACTGCTGAAGCTGTACTTCAAAAAATGGATGACATGAAGAAGATGCGTAGACAGCGAATGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

S Hong et al.
Neoplasma, 63(6), 846-855 (2016-08-28)
Colorectal cancer is one of the most common malignant tumors with a high rate of distant metastasis, postoperative recurrence and mortality. ATPase family AAA domain-containing protein 2 (ATAD2), a member of ATPase family, is highly expressed in various cancers, including
Le Zheng et al.
Oncology reports, 33(5), 2337-2344 (2015-03-31)
The ATPase family AAA domain-containing protein 2 (ATAD2) is associated with many cellular processes, such as cell proliferation, invasion and migration. However, the molecular biological function of the ATAD2 gene in cervical cancer is unclear. The purpose of this study
Wen-Jing Lu et al.
Oncotarget, 6(39), 41722-41735 (2015-10-27)
The ATPase family, AAA domain containing 2 (ATAD2) is highly expressed in multiple cancers. We aim to understand the clinical and biological significance of ATAD2 over-expression in hepatocellular carcinoma (HCC), as a means to validate it as a therapeutic target

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico