Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU121641

Sigma-Aldrich

MISSION® esiRNA

targeting human FZD7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGGCCTGCTACTTCTACGAGCAGGCCTTCCGCGAGCACTGGGAGCGCACCTGGCTCCTGCAGACGTGCAAGAGCTATGCCGTGCCCTGCCCGCCCGGCCACTTCCCGCCCATGAGCCCCGACTTCACCGTCTTCATGATCAAGTACCTGATGACCATGATCGTCGGCATCACCACTGGCTTCTGGATCTGGTCGGGCAAGACCCTGCAGTCGTGGCGCCGCTTCTACCACAGACTTAGCCACAGCAGCAAGGGGGAGACTGCGGTATGAGCCCCGGCCCCTCCCCACCTTTCCCACCCCAGCCCTCTTGCAAGAGGAGAGGCACGGTAGGGAAAAGAACTGCTGGGTGGGGGCCTGTTTCTGTAACTTTCTCCCCCTCTACTGAGAAGTGACCTGGAAGTGAGAAGTTCTTTGCAGATTTGGGGCGAGGGGTGATTTGGAAAAGAAGACCTGGGTG

Ensembl | nº de acceso humano

ENSG00000155760

Nº de acceso NCBI

NM_003507

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FZD7(8324) , FZD7(8324)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yan Geng et al.
Oncology reports, 35(4), 2441-2450 (2016-01-20)
MicroRNAs (miRNAs) are novel tools for cancer therapy. Frizzled7 (FZD7) is an important co-receptor in the WNT signaling pathway. The WNT signaling pathway is aberrantly activated in Helicobacter pylori (H. pylori)‑infected gastric cancer cells. However, the role of FZD7 in
Yufeng Wang et al.
Cell death & disease, 9(9), 851-851 (2018-08-30)
Previous evidences reveal that long non-coding RNA (lncRNA) down syndrome critical region 8 (DSCR8) involves in the progression of multiple cancers. However, the exact expression, function, and mechanism of DSCR8 in hepatocellular carcinoma (HCC) remain uncovered. In this study, real-time
M Asad et al.
Cell death & disease, 5, e1346-e1346 (2014-07-18)
Ovarian cancer (OC) can be classified into five biologically distinct molecular subgroups: epithelial-A (Epi-A), Epi-B, mesenchymal (Mes), Stem-A and Stem-B. Among them, Stem-A expresses genes relating to stemness and is correlated with poor clinical prognosis. In this study, we show
Salvatore Condello et al.
Cancer research, 78(11), 2990-3001 (2018-03-08)
Cancer progression and recurrence are linked to a rare population of cancer stem cells (CSC). Here, we hypothesized that interactions with the extracellular matrix drive CSC proliferation and tumor-initiating capacity and investigated the functions of scaffold protein tissue transglutaminase (TG2)
Liang-Jie Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 314-326 (2018-07-07)
Migration of placental extravillous trophoblast (EVT) cells into uterine decidua facilitates the establishment of blood circulation between mother and fetus and is modulated by EVT-decidual cell interaction. Poor or excessive EVT migration is associated with pregnancy complications such as preeclampsia
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico