Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU119261

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTCTGCTCCTTGCCTTTCACGATTTTTGCATATATGAATGAAACCTCTTCCCGAAAGGAAAAATGGGACCTCCAAGCTCTTAGGTTTTTATCAATTAATTCAATAATTGACCCTTGGGTCTTTGCCATCCTTAGGCCTCCTGTTCTGAGACTAATGCGTTCAGTCCTCTGTTGTCGGATTTCATTAAGAACACAAGATGCAACACAAACTTCCTGTTCTACACAGTCAGATGCCAGTAAACAGGCTGACCTTTGAGGTCAGTAGTTTAAAAGTTCTTAGTTATATAGCATCTGGAAGATCATTTTGAAATTGTTCCTTGGAGAAATGAAAACAGTGTGTAAACAAAATGAAGCTGCCCTAATAAAAAGGAGTATACAAACATTTAAGCTGTGGTCAAGGCTACAGATGTGCTGACAAGGCACTTCATGTAAAGTGTCAGAAGGAGCTACAAAACCTACCCTCAGTGAGCATGGTACTTGGCCTTTGGAGGAACAATCGGCTGCATTGAAGATCCAGCTGCCT

Ensembl | nº de acceso humano

ENSG00000125384

Nº de acceso NCBI

NM_000956

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PTGER2(5732) , PTGER2(5732)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qian Zhang et al.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association, 34(4), 606-617 (2018-07-10)
Secondary hyperparathyroidism (SHPT) in patients with end-stage renal disease (ESRD) is characterized by hyperplasia of the parathyroid glands (PTGs), while the underlying mechanism is not completely understood. Previously we demonstrated a relationship between cyclooxygenase 2 (COX2) overexpression and parathyroid hyperplasia
Jigisha A Patel et al.
International journal of molecular sciences, 19(8) (2018-08-15)
Prostacyclins are extensively used to treat pulmonary arterial hypertension (PAH), a life-threatening disease involving the progressive thickening of small pulmonary arteries. Although these agents are considered to act therapeutically via the prostanoid IP receptor, treprostinil is the only prostacyclin mimetic
Fusako Sakai-Takemura et al.
Communications biology, 3(1), 182-182 (2020-04-22)
Understanding the signaling pathways that regulate proliferation and differentiation of muscle progenitors is essential for successful cell transplantation for treatment of Duchenne muscular dystrophy. Here, we report that a γ-secretase inhibitor, DAPT (N-[N-(3,5-difluorophenacetyl-L-alanyl)]-S-phenylglycine tertial butyl ester), which inhibits the release

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico