Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU116031

Sigma-Aldrich

MISSION® esiRNA

targeting human FDPS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGCTGCAAGCTTTCTTCCTGGTGGCAGATGACATCATGGATTCATCCCTTACCCGCCGGGGACAGATCTGCTGGTATCAGAAGCCGGGCGTGGGTTTGGATGCCATCAATGATGCTAACCTCCTGGAAGCATGTATCTACCGCCTGCTGAAGCTCTATTGCCGGGAGCAGCCCTATTACCTGAACCTGATCGAGCTCTTCCTGCAGAGTTCCTATCAGACTGAGATTGGGCAGACCCTGGACCTCCTCACAGCCCCCCAGGGCAATGTGGATCTTGTCAGATTCACTGAAAAGAGGTACAAATCTATTGTCAAGTACAAGACAGCTTTCTACTCCTTCTACCTTCCTATAGCTGCAGCCATGTACATGGCAGGAATTGATGGCGAGAAGGAGCACGCCAATGCCAAGAAGATCCTGCTGGAGATGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Elena Ciaglia et al.
British journal of pharmacology, 174(14), 2287-2301 (2017-04-19)
N We designed and synthesized i6A derivatives characterized by the introduction of diverse chemical moieties in the N6 position of adenosine and tested for their efficacy in U87 cells and in primary glioma cultures, derived from patients. NMR-based structural analysis
Sholeem Griffin et al.
Biology of reproduction, 99(4), 749-760 (2018-04-25)
Preventing postpartum uterine disease depends on the ability of endometrial cells to tolerate the presence of the bacteria that invade the uterus after parturition. Postpartum uterine disease and endometrial pathology in cattle are most associated with the pathogen Trueperella pyogenes.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico