Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU114911

Sigma-Aldrich

MISSION® esiRNA

targeting human FAM35A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGCTACATTCCAGGCATTGTACTAAGTATGGGGAACCACAGAGAAGACATTCCCTCAGAAACTGCTGCAGTGCTTTCGCTTATCCCTACCTAAAAAACCGTCAATGTGAAATCATTTCCTTGATTATAACTATAATGATAATGGATTAGTTTATATAAACCTATGTTTAGACAAGTTCAAGACAAGCGTGTCTTTCTATAAAAAGTATTGAAAATGAAGGAAATGAGATCATGTTTCAATTTATTAAAGCAGGGAAGAGCGTTCTGTGCTTAGTTCGTGTCTAGGATTTGAGTGCCTTACTGAATGCATTTACCAGCAAACATGTAGCAATCTGTTCTCTCATTGTGATTGTGGAAGAAGCTCATGTAAAATGATAGTCATTAATGAGGAAGTATGGCGTGG

Ensembl | nº de acceso humano

ENSG00000165874

Nº de acceso NCBI

NM_019054

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FAM35A(54537) , FAM35A(54537)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shengxian Gao et al.
Nature communications, 9(1), 3925-3925 (2018-09-27)
53BP1 with its downstream proteins, RIF1, PTIP and REV7, antagonizes BRCA1-dependent homologous recombination (HR) and promotes non-homologous end joining (NHEJ) in an unclear manner. Here we show that REV7 forms a complex with two proteins, FAM35A and C20ORF196. We demonstrate
Sylvie M Noordermeer et al.
Nature, 560(7716), 117-121 (2018-07-20)
53BP1 is a chromatin-binding protein that regulates the repair of DNA double-strand breaks by suppressing the nucleolytic resection of DNA termini1,2. This function of 53BP1 requires interactions with PTIP3 and RIF14-9, the latter of which recruits REV7 (also known as

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico