Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU113921

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG4B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCAGCCAGACAGCTACTTCAGCGTCCTCAACGCATTCATCGACAGGAAGGACAGTTACTACTCCATTCACCAGATAGCGCAAATGGGAGTTGGCGAAGGCAAGTCCATAGGCCAGTGGTACGGGCCCAACACTGTCGCCCAGGTCCTGAAGAAGCTTGCTGTCTTCGATACGTGGAGCTCCTTGGCGGTCCACATTGCAATGGACAACACTGTTGTGATGGAGGAAATCAGAAGGTTGTGCAGGACCAGCGTTCCCTGTGCAGGCGCCACTGCGTTTCCTGCAGATTCCGACCGGCACTGCAACGGATTCCCTGCCGGAGCTGAGGTCACCAACAGGCCGTCGCCATGGAGACCCCTGGTACTTCTCATTCCCCTGCGCCTGGGGCTCACGGACATCAACGAGGCCTACGT

Ensembl | nº de acceso humano

ENSG00000168397

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ATG4B(23192) , ATG4B(23192)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yao-Xin Lin et al.
Biomaterials, 141, 199-209 (2017-07-10)
Autophagic therapy is regarded as a promising strategy for disease treatment. Appropriate autophagy regulations in vivo play a crucial role in translating this new concept from benchside to bedside. So far, emerging technologies are required to spatially and quantitatively monitor autophagic
Yao-Xin Lin et al.
ACS nano, 11(2), 1826-1839 (2017-01-24)
Autophagy plays a crucial role in the metabolic process. So far, conventional methods are incapable of rapid, precise, and real-time monitoring of autophagy in living objects. Herein, we describe an in situ intracellular self-assembly strategy for quantitative and temporal determination
Tianzhi Huang et al.
Cancer cell, 32(6), 840-855 (2017-12-13)
ATG4B stimulates autophagy by promoting autophagosome formation through reversible modification of ATG8. We identify ATG4B as a substrate of mammalian sterile20-like kinase (STK) 26/MST4. MST4 phosphorylates ATG4B at serine residue 383, which stimulates ATG4B activity and increases autophagic flux. Inhibition
Pei-Feng Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 728-740 (2017-11-24)
ATG4B is a cysteine protease required for autophagy, which is a cellular catabolic pathway involved in energy balance. ATG4B expression is elevated during tumor growth in certain types of cancer, suggesting that ATG4B is an attractive target for cancer therapy.
Elisabeth Corcelle-Termeau et al.
Autophagy, 12(5), 833-849 (2016-04-14)
Sphingomyelin is an essential cellular lipid that traffics between plasma membrane and intracellular organelles until directed to lysosomes for SMPD1 (sphingomyelin phosphodiesterase 1)-mediated degradation. Inactivating mutations in the SMPD1 gene result in Niemann-Pick diseases type A and B characterized by
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico