Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU112661

Sigma-Aldrich

MISSION® esiRNA

targeting human BNIP3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGGACGGAGTAGCTCCAAGAGCTCTCACTGTGACAGCCCACCTCGCTCGCAGACACCACAAGATACCAACAGAGCTTCTGAAACAGATACCCATAGCATTGGAGAGAAAAACAGCTCACAGTCTGAGGAAGATGATATTGAAAGAAGGAAAGAAGTTGAAAGCATCTTGAAGAAAAACTCAGATTGGATATGGGATTGGTCAAGTCGGCCGGAAAATATTCCCCCCAAGGAGTTCCTCTTTAAACACCCGAAGCGCACGGCCACCCTCAGCATGAGGAACACGAGCGTCATGAAGAAAGGGGGCATATTCTCTGCAGAATTTCTGAAAGTTTTCCTTCCATCTCTGCTGCT

Ensembl | nº de acceso humano

ENSG00000176171

Nº de acceso NCBI

NM_004052

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BNIP3(664) , BNIP3(664)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QWU
MDT
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xianjie Li et al.
International journal of molecular medicine, 46(2), 729-739 (2020-07-07)
Long non‑coding RNA (lncRNA) DGCR5 has been identified as a tumor suppressor in several types of cancer. However, its biological functions in pancreatic cancer (PaCa) have not yet been fully elucidated. The present study was designed to investigate the role
Yanan Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 120, 109464-109464 (2019-10-08)
The study was established to inquire into the protective effect of the HIF-1α (Hypoxia-inducible factor-1α)/ BNIP3(Bcl-2/adenovirus E1B 19-kDa interacting protein) signal path-induced-autophagy during myocardial ischemia/ reperfusion (I/R) and oxygen-glucose deprivation/recovery (OGD/R) injury in heart-derived H9C2 cells as well as its
Zhiliang He et al.
Acta biochimica et biophysica Sinica, 49(1), 25-32 (2016-11-20)
Nutrition deficiency is reported to induce apoptosis of chondrocytes and degeneration of cartilage endplate (CEP) in rabbit. Cartilage endplate stem cells (CESCs) are important for the integrity of structure and function of CEP. Bcl-2/adenovirus E1B 19-kDa-interacting protein 3 (BNIP3) has
Zong-Jie Fu et al.
Redox biology, 36, 101671-101671 (2020-08-24)
In the present study, we hypothesized that hypoxia-inducible factor 1α (HIF-1α)-mediated mitophagy plays a protective role in ischemia/reperfusion (I/R)-induced acute kidney injury (AKI). Mitophagy was evaluated by measuring the changes of mitophagy flux, mitochondria DNA copy number, and the changes
Jie Liu et al.
Molecular medicine reports, 16(5), 7253-7260 (2017-09-26)
Nutrient deprivation (ND)‑induced nucleus pulposus (NP) cell death serves an important role in intervertebral disc degeneration disease. However, the underlying mechanisms have yet to be thoroughly elucidated. The present study created a cell culture model under ND conditions to investigate
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico