Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU110781

Sigma-Aldrich

MISSION® esiRNA

targeting human FEN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATGTGCTGCAGAATGAGGAGGGTGAGACCACCAGCCACCTGATGGGCATGTTCTACCGCACCATTCGCATGATGGAGAACGGCATCAAGCCCGTGTATGTCTTTGATGGCAAGCCGCCACAGCTCAAGTCAGGCGAGCTGGCCAAACGCAGTGAGCGGCGGGCTGAGGCAGAGAAGCAGCTGCAGCAGGCTCAGGCTGCTGGGGCCGAGCAGGAGGTGGAAAAATTCACTAAGCGGCTGGTGAAGGTCACTAAGCAGCACAATGATGAGTGCAAACATCTGCTGAGCCTCATGGGCATCCCTTATCTTGATGCACCCAGTGAGGCAGAGGCCAGCTGTGCTGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCTACCGAGGACATGGACTGCCTCACCTT

Ensembl | nº de acceso humano

ENSG00000168496

Nº de acceso NCBI

NM_004111

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FEN1(2237) , FEN1(2237)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Song-Bai Liu et al.
Combinatorial chemistry & high throughput screening, 22(6), 379-386 (2019-07-06)
Flap endonuclease-1 (FEN1) plays a central role in DNA replication and DNA damage repair process. In mammals, FEN1 functional sites variation is related to cancer and chronic inflammation, and supports the role of FEN1 as a tumor suppressor. However, FEN1
Xue Zeng et al.
Experimental and therapeutic medicine, 14(4), 3265-3272 (2017-09-16)
Trastuzumab has been widely applied as a treatment for human epidermal growth factor 2 (HER2)-overexpressing breast cancer. However, the therapeutic efficacy of trastuzumab is limited. Flap endonuclease 1 (FEN1) is a multifunctional endonuclease that has a crucial role in DNA
Keqiang Zhang et al.
The American journal of pathology, 188(1), 242-251 (2017-10-19)
Flap endonuclease 1 (FEN1) plays a crucial role in both DNA replication and damage repair. In this study, FEN1 expression and its clinical-pathologic significance in non-small-cell lung cancer (NSCLC) was investigated. Quantitative RT-PCR and immunohistochemistry analysis identified that both FEN1
Xue Zeng et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 10717-10730 (2019-07-04)
Flap endonuclease 1 (FEN1) is recognized as a pivotal factor in DNA replication, long-patch excision repair, and telomere maintenance. Excessive FEN1 expression has been reported to be closely associated with cancer progression, but the specific mechanism has not yet been
Y Wang et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(8), 1026-1033 (2019-02-04)
Flap endonuclease 1 (FEN1) is up-regulated by estrogen (17β-estradiol, E2) and related to cisplatin resistance of human breast cancer cells. Letrozole, an aromatase inhibitor, suppresses the change of testosterone into estrogen and is frequently used to treat breast cancer. However
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico