Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU110401

Sigma-Aldrich

MISSION® esiRNA

targeting human IDH1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCCCAAGCTATGAAATCAGAGGGAGGCTTCATCTGGGCCTGTAAAAACTATGATGGTGACGTGCAGTCGGACTCTGTGGCCCAAGGGTATGGCTCTCTCGGCATGATGACCAGCGTGCTGGTTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCACGGGACTGTAACCCGTCACTACCGCATGTACCAGAAAGGACAGGAGACGTCCACCAATCCCATTGCTTCCATTTTTGCCTGGACCAGAGGGTTAGCCCACAGAGCAAAGCTTGATAACAATAAAGAGCTTGCCTTCTTTGCAAATGCTTTGGAAGAAGTCTCTATTGAGACAATTGAGGCTGGCTTCATGACCAAGGACTTGGCTGCTTGCATTAAAGGTTTACCCAATGTGCAACGTTCTGAC

Ensembl | nº de acceso humano

ENSG00000138413

Nº de acceso NCBI

NM_005896

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IDH1(3417) , IDH1(3417)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
FCU
NXT
CXS
QCS
IBS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Daniel R Wahl et al.
Cancer research, 77(4), 960-970 (2016-12-08)
NADPH is a critical reductant needed in cancer cells to fuel the biosynthesis of deoxynucleotides and antioxidants and to sustain stress-survival responses after radiation-induced DNA damage. Thus, one rational strategy to attack cancer cells is to target their heavy reliance
Qi Wang et al.
Oncology reports, 43(1), 188-200 (2019-11-21)
Mutation of the isocitrate dehydrogenase (IDH) gene is regarded a novel indicator for the prognosis of patients with glioma. However, the role of the IDH1 gene mutations in carcinogenesis and the mechanisms underlying their function in glioblastoma multiforme (GBM) remain
Xiayi Liu et al.
Journal of cellular physiology, 234(7), 11602-11609 (2018-11-30)
DDIT3 is of great importance in endoplasmic reticulum stress and is involved in many inflammatory diseases and mineralization processes. The cementum protects teeth from periodontitis and provides attachment for Sharpey's fibers of the periodontal ligament. However, the effect of DDIT3
Chan Chung et al.
Cancer cell, 38(3), 334-349 (2020-08-17)
H3K27M diffuse intrinsic pontine gliomas (DIPGs) are fatal and lack treatments. They mainly harbor H3.3K27M mutations resulting in H3K27me3 reduction. Integrated analysis in H3.3K27M cells, tumors, and in vivo imaging in patients showed enhanced glycolysis, glutaminolysis, and tricarboxylic acid cycle metabolism

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico