Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU108371

Sigma-Aldrich

MISSION® esiRNA

targeting human ACTR3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTCAAAGGAGGGTGATGAAAGGTGTTGATGACCTAGACTTCTTCATTGGTGATGAAGCAATAGAAAAACCTACATATGCAACAAAGTGGCCAATCCGCCATGGTATAGTTGAAGATTGGGACTTAATGGAAAGGTTTATGGAGCAAGTGATCTTTAAATATTTAAGGGCAGAACCTGAAGACCATTATTTTCTTTTGACTGAACCTCCATTGAATACTCCAGAAAACAGGGAATATACTGCTGAAATAATGTTTGAGTCCTTCAATGTTCCAGGCTTGTACATTGCTGTGCAGGCTGTTCTTGCCTTAGCTGCATCTTGGACCTCAAGACAAGTAGGAGAACGGACGTTGACCGGTACGGTAATAGACAGTGGAGATGGTGTCACTCATGTCATTCCTGTGGCTGAAGGGTATGT

Ensembl | nº de acceso humano

ENSG00000115091

Nº de acceso NCBI

NM_005721

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ACTR3(10096) , ACTR3(10096)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Meraj H Khan et al.
Journal of cell science, 130(18), 3094-3107 (2017-08-05)
Sharpin, a multifunctional adaptor protein, regulates several signalling pathways. For example, Sharpin enhances signal-induced NF-κB signalling as part of the linear ubiquitin assembly complex (LUBAC) and inhibits integrins, the T cell receptor, caspase 1 and PTEN. However, despite recent insights
Daniel L Galvan et al.
The Journal of clinical investigation, 129(7), 2807-2823 (2019-05-08)
Phosphorylation of Dynamin-related protein1 (Drp1) represents an important regulatory mechanism for mitochondrial fission. Here we established the role of Drp1 Serine 600 (S600) phosphorylation on mitochondrial fission in vivo, and assessed the functional consequences of targeted elimination of the Drp1S600
Aleksandra S Chikina et al.
Biology of the cell, 111(10), 245-261 (2019-08-14)
Metastatic disease is caused by the ability of cancer cells to reach distant organs and form secondary lesions at new locations. Dissemination of cancer cells depends on their migration plasticity - an ability to switch between motility modes driven by

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico