Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU108271

Sigma-Aldrich

MISSION® esiRNA

targeting human BRD7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAAGTGATTTCAGCATCCATGAGTTTTTGGCCACGTGCCAAGATTATCCGTATGTCATGGCAGATAGTTTACTGGATGTTTTAACAAAAGGAGGGCATTCCAGGACCCTACAAGAGATGGAGATGTCATTGCCTGAAGATGAAGGCCATACTAGGACACTTGACACAGCAAAAGAAATGGAGATTACAGAAGTAGAGCCACCAGGGCGTTTGGACTCCAGTACTCAAGACAGGCTCATAGCGCTGAAAGCAGTAACAAATTTTGGCGTTCCAGTTGAAGTTTTTGACTCTGAAGAAGCTGAAATATTCCAGAAGAAACTTGATGAGACCACCAGATTGCTCAGGGAACTCCAGGAAGCCCAGAATGAACGTTTGAGCACCAGACCCCCTCCGAACATGATCTGTCTCTTGGGTCCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lena Golick et al.
Cellular and molecular life sciences : CMLS, 75(10), 1857-1869 (2017-11-12)
Reduced hepatic expression levels of bromodomain-containing protein 7 (BRD7) have been suggested to play a role in the development of glucose intolerance in obesity. However, the molecular mechanism by which BRD7 regulates glucose metabolism has remained unclear. Here, we show
Xiao-Meng Wang et al.
Journal of cellular and molecular medicine, 21(6), 1094-1105 (2016-12-14)
Bromodomain-containing protein 7 (BRD7) is a tumour suppressor that is known to regulate many pathological processes including cell growth, apoptosis and cell cycle. Endoplasmic reticulum (ER) stress-induced apoptosis plays a key role in diabetic cardiomyopathy (DCM). However, the molecular mechanism

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico