Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU106031

Sigma-Aldrich

MISSION® esiRNA

targeting human CDC20

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTACAGCCAAAAGGCCACTCCTGGCTCCAGCCGGAAGACCTGCCGTTACATTCCTTCCCTGCCAGACCGTATCCTGGATGCGCCTGAAATCCGAAATGACTATTACCTGAACCTTGTGGATTGGAGTTCTGGGAATGTACTGGCCGTGGCACTGGACAACAGTGTGTACCTGTGGAGTGCAAGCTCTGGTGACATCCTGCAGCTTTTGCAAATGGAGCAGCCTGGGGAATATATATCCTCTGTGGCCTGGATCAAAGAGGGCAACTACTTGGCTGTGGGCACCAGCAGTGCTGAGGTGCAGCTATGGGATGTGCAGCAGCAGAAACGGCTTCGAAATATGACCAGTCACTCTGCCCGAGTGGGCTCCCTAAGCTGGAACAGCTATATCCTGTCCAGTGGTTCACGTTCTGGCCACATCCACCACCATGATGT

Ensembl | nº de acceso humano

ENSG00000117399

Nº de acceso NCBI

NM_001255

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CDC20(991) , CDC20(991)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
OWU
MOU
EHS
RWS
IVR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuan Gao et al.
Aging, 13(2), 2668-2680 (2021-01-08)
The molecular mechanism of osteosarcoma (OS) pathogenesis is poorly understood. The Notch signaling pathway has been shown to be critically involved in tumorigenesis, including OS. Therefore, we explored the molecular mechanism by which the Notch-1 signaling pathway is involved in
Shujie Cheng et al.
International journal of oncology, 54(6), 2250-2256 (2019-05-14)
Aberrant expression of cell division cycle 20 (CDC20) is associated with malignant progression and poor prognosis in various types of cancer. The development of specific CDC20 inhibitors may be a novel strategy for the treatment of cancer with elevated expression of
Jia Li et al.
International journal of oncology, 45(4), 1547-1555 (2014-07-30)
Cell division cycle 20 (CDC20) encodes a regulatory protein interacting with the anaphase-promoting complex/cyclosome (APC/C) in the cell cycle and plays important roles in tumorigenesis and progression of multiple tumors. The present study aimed to investigate the clinical significance of
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Karine Boulay et al.
Nucleic acids research, 42(12), 7867-7883 (2014-06-08)
Staufen1 (Stau1) is a ribonucleic acid (RNA)-binding protein involved in the post-transcriptional regulation of gene expression. Recent studies indicate that Stau1-bound messenger RNAs (mRNAs) mainly code for proteins involved in transcription and cell cycle control. Consistently, we report here that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico