Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU105981

Sigma-Aldrich

MISSION® esiRNA

targeting human BMPR1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCAAGAGCATCTCAAGCAGACGTCGTTACAATCGTGATTTGGAACAGGATGAAGCATTTATTCCAGTTGGAGAATCACTAAAAGACCTTATTGACCAGTCACAAAGTTCTGGTAGTGGGTCTGGACTACCTTTATTGGTTCAGCGAACTATTGCCAAACAGATTCAGATGGTCCGGCAAGTTGGTAAAGGCCGATATGGAGAAGTATGGATGGGCAAATGGCGTGGCGAAAAAGTGGCGGTGAAAGTATTCTTTACCACTGAAGAAGCCAGCTGGTTTCGAGAAACAGAAATCTACCAAACTGTGCTAATGCGCCATGAAAACATACTTGGTTTCATAGCGGCAGACATTAAAGGTACAGGTTCCTGGACTCAGCTCTATTTGATTACTGATTACCATGAAAATGGATCTCTCTATGACTTCCTGAAATGTGCTACACTGGACACCAGAGCCCTGCTTAAATTGGCTTATTCAGCTGCCTGTGGTCTGTGCCACCTGCACACAGAAATTTATGGCACCCAAGGAAAG

Ensembl | nº de acceso humano

ENSG00000107779

Nº de acceso NCBI

NM_004329

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BMPR1A(657) , BMPR1A(657)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wencai Shi et al.
Biological trace element research, 176(2), 294-304 (2016-09-24)
Hepcidin synthesis is reported to be inadequate according to the body iron store in patients with non-alcoholic fatty liver disease (NAFLD) undergoing hepatic iron overload (HIO). However, the underlying mechanisms remain unclear. We hypothesize that hepatocyte nuclear factor-4α (HNF-4α) may
Zhixian Yu et al.
PloS one, 11(12), e0168334-e0168334 (2016-12-16)
Approximately 30% of tumor endothelial cells have over-duplicated (>2) centrosomes, which may contribute to abnormal vessel function and drug resistance. Elevated levels of vascular endothelial growth factor A induce excess centrosomes in endothelial cells, but how other features of the
Mian Guo et al.
Carcinogenesis, 35(8), 1698-1706 (2014-02-01)
Bone morphogenetic protein-2 (BMP-2), a member of the transforming growth factor-β family, plays critical roles in cell differentiation, modeling and regeneration processes in several tissues. BMP-2 is also closely associated with various malignant tumors. microRNAs negatively and posttranscriptionally regulate gene

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico