Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU105721

Sigma-Aldrich

MISSION® esiRNA

targeting human PCNA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCGTGAACCTCACCAGTATGTCCAAAATACTAAAATGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCGCTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGATTTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCTTCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATTAAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAATGAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCACTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAAATTGCGGATATGGGACA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Amy Kwan et al.
Molecular cancer therapeutics, 20(3), 589-601 (2020-12-11)
Oncolytic viruses (OV) have been shown to activate the antitumor functions of specific immune cells like T cells. Here, we show OV can also reprogram tumor-associated macrophage (TAM) to a less immunosuppressive phenotype. Syngeneic, immunocompetent mouse models of primary breast
Keiichiro Sakuma et al.
Cancer science, 109(8), 2458-2468 (2018-06-06)
Heterogeneous nuclear ribonucleoprotein L-like (HNRNPLL), an RNA-binding protein that regulates alternative splicing of pre-mRNA, has been shown to regulate differentiation of lymphocytes, as well as metastasis of colorectal cancer cells. Here, we show that HNRNPLL promotes cell cycle progression and
N Kanu et al.
Oncogene, 35(30), 4009-4019 (2015-11-10)
The DNA replication machinery invariably encounters obstacles that slow replication fork progression, and threaten to prevent complete replication and faithful segregation of sister chromatids. The resulting replication stress activates ATR, the major kinase involved in resolving impaired DNA replication. In
Joachim Garbrecht et al.
Nucleus (Austin, Tex.), 9(1), 474-491 (2018-09-13)
Fluorescence microscopy in combination with the induction of localized DNA damage using focused light beams has played a major role in the study of protein recruitment kinetics to DNA damage sites in recent years. Currently published methods are dedicated to
Wanwan Jia et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 4031-4042 (2018-02-27)
Rheumatoid arthritis (RA) is an immune-mediated disease with the characteristics of progressive joint destruction, deformity, and disability. Epigenetic changes have been implicated in the development of some autoimmune disorders, resulting in an alteration of gene transcription. Here, we investigated how

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico