Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU102911

Sigma-Aldrich

MISSION® esiRNA

targeting human RACK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGAGTGTGGCCTTCTCCTCTGACAACCGGCAGATTGTCTCTGGATCTCGAGATAAAACCATCAAGCTATGGAATACCCTGGGTGTGTGCAAATACACTGTCCAGGATGAGAGCCACTCAGAGTGGGTGTCTTGTGTCCGCTTCTCGCCCAACAGCAGCAACCCTATCATCGTCTCCTGTGGCTGGGACAAGCTGGTCAAGGTATGGAACCTGGCTAACTGCAAGCTGAAGACCAACCACATTGGCCACACAGGCTATCTGAACACGGTGACTGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGAGGCAAGGATGGCCAGGCCATGTTATGGGATCTCAACGAAGGCAAACACCTTTACACGCTAGATGGTGGGGACATCATCAACGCCCTGTGCTTCAGCCCTAACCGCTACTGGCTGTGTG

Ensembl | nº de acceso humano

ENSG00000204628

Nº de acceso NCBI

NM_006098

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RACK1(10399) , GNB2L1(10399)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
NLU
GZT
QHS
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lei Zhang et al.
OncoTargets and therapy, 12, 1007-1020 (2019-02-19)
The expression and function of the Receptor for Activated C Kinase 1 (RACK1) in cancer growth and metastasis are confused in different cancers, especially in pancreatic ductal adenocarcinoma (PDAC). One-hundred and eighty-two PDAC tissue specimens (95 males and 87 females)
Yi Hu et al.
Cancer letters, 450, 144-154 (2019-03-09)
Receptor of activated protein kinase C 1 (RACK1) is downregulated in gastric cancer and is involved in modulating NF-κB signaling pathway activity. However, the underlying molecular mechanisms regulating RACK1 expression are unclear. In this study, we demonstrated that downregulated expression
Sujata Jha et al.
Nature, 546(7660), 651-655 (2017-06-22)
Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we
Wenting He et al.
Journal of Alzheimer's disease : JAD, 75(2), 451-460 (2020-04-07)
Accumulation of amyloid-β (Aβ) peptides, generated from amyloid-β precursor protein (AβPP) amyloidogenic processing, is one of the most salient disease hallmarks of Alzheimer's disease (AD). Nicotine is able to promote α-secretase-mediated AβPP nonamyloidogenic processing and increase the release of sAβPPα
Zhao-Fei Dong et al.
Molecular neurobiology, 50(2), 438-448 (2014-01-18)
Voltage-gated sodium channel α subunit type I (Nav1.1, encoded by SCN1A gene) plays a critical role in the initiation of action potential in the central nervous system. Downregulated expression of SCN1A is believed to be associated with epilepsy. Here, we
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico