Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU100421

Sigma-Aldrich

MISSION® esiRNA

targeting human FGFR1 (1)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCTCTGACAAGGGCAACTACACCTGCATTGTGGAGAATGAGTACGGCAGCATCAACCACACATACCAGCTGGATGTCGTGGAGCGGTCCCCTCACCGGCCCATCCTGCAAGCAGGGTTGCCCGCCAACAAAACAGTGGCCCTGGGTAGCAACGTGGAGTTCATGTGTAAGGTGTACAGTGACCCGCAGCCGCACATCCAGTGGCTAAAGCACATCGAGGTGAATGGGAGCAAGATTGGCCCAGACAACCTGCCTTATGTCCAGATCTTGAAGACTGCTGGAGTTAATACCACCGACAAAGAGATGGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuanxia Huang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 85, 41-46 (2016-12-09)
Cartilage degeneration is known as a major cause of osteoarthritis (OA). C1q/TNF-related protein-3 (CTRP3) is an adipokine relative to chondrogenesis in vitro. However, its effect on cartilage degeneration in OA remains unclearly. In the present study, SW1353 cells were treated
Hidenori Kitai et al.
Cancer discovery, 6(7), 754-769 (2016-05-08)
KRAS is frequently mutated in lung cancer. Whereas MAPK is a well-known effector pathway of KRAS, blocking this pathway with clinically available MAPK inhibitors is relatively ineffective. Here, we report that epithelial-to-mesenchymal transition rewires the expression of receptor tyrosine kinases
Jiexia Zhang et al.
International journal of oncology, 54(6), 2211-2221 (2019-04-04)
Emerging reports have revealed that several microRNAs (miRNAs) are abnormally expressed in non‑small cell lung cancer (NSCLC). miRNAs have been identified as oncogenes or tumor suppressors, and regulate various biological processes including oncogenesis and development. miR‑802 is dysregulated in multiple
Fei Ma et al.
Journal of experimental & clinical cancer research : CR, 36(1), 158-158 (2017-11-15)
MicroRNAs function as key regulators in various human cancers, including breast cancer (BC). MiR-361-5p has been proved to be a tumor suppressor in colorectal cancer and gastric cancer in our previous study. In this study, we aim to find out
Liyan Wang et al.
FEBS letters, 590(23), 4252-4262 (2016-10-23)
MiR-296 was previously reported to be underexpressed in hepatocellular carcinoma (HCC). However, the clinical value of miR-296 and its function in HCC remain poorly understood. In this study, we found that miR-296 levels are decreased in HCC specimens and cells

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico