Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU099841

Sigma-Aldrich

MISSION® esiRNA

targeting human MCAT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGATGCATGCCATATACGAAAGGAAAAAGGGCAGGGGGTTCCCCCAAACTTTCGAAGTAGGCCCTGGCAGGCAGCTGGGAGCCATCCTGAAGAGCTGTAACATGCAGGCCTGGAAGTCCTACAGCGCCGTGGATGTGCTGCAGACCCTCGAACATGTGGACCTGGACCCTCAGGAGCCCCCGAGATGACTGCAGGGGGCTCAAATGCGATGACCCCCTCTGTCCTCCTGAGGAGAGGCTGTAGGCTGTGCCTGTCGCCCCCTACCTTCCTAATGGCTCCTCCTCTGAGGAGTGAAAGGGATTTGTTTGCAACG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mads Bengtsen et al.
Biochimica et biophysica acta, 1860(7), 751-760 (2017-05-13)
LIM-domain proteins, containing multiple cysteine-rich zinc finger-like motifs, have been shown to play diverse roles in several cellular processes. A common theme is that they mediate important protein-protein interactions that are key to their function. Androgen receptor-associated protein 55 (ARA55)
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico