Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU098081

Sigma-Aldrich

MISSION® esiRNA

targeting human CENPA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACAATCAACACCGTTCCAAAGGCCTGAAAATAATTTTCAGATAAAGAGACTCCAAGGTTGACTTTAGTTTGTGAGTTACTCATGTGACTATTTGAGGATTTTGAAAACATCAGATTTGCTGTGGTATGGGAGAAAAGGCTATGTACTTATTATTTTAGCTCTTTCTGTAATATTTACATTTTTTACCATATGTACATTTGTACTTTTATTTTACACATAAGGGAAAAAATAAGACCACTTTGAGCAGTTGCCTGGAAGGCTGGGCATTTCCATCATATAGACCTCTGCCCTTCAGAGTAGCCTCACCATTAGTGGCAGCATC

Ensembl | nº de acceso humano

ENSG00000115163

Nº de acceso NCBI

NM_001042426
NM_001809

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CENPA(1058) , CENPA(1058)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mamoru Takada et al.
Cancer research, 77(18), 4881-4893 (2017-08-02)
The centromere regulates proper chromosome segregation, and its dysfunction is implicated in chromosomal instability (CIN). However, relatively little is known about how centromere dysfunction occurs in cancer. Here, we define the consequences of phosphorylation by cyclin E1/CDK2 on a conserved
S Zachary Swartz et al.
Developmental cell, 51(1), 35-48 (2019-08-20)
Centromeres provide a robust model for epigenetic inheritance as they are specified by sequence-independent mechanisms involving the histone H3-variant centromere protein A (CENP-A). Prevailing models indicate that the high intrinsic stability of CENP-A nucleosomes maintains centromere identity indefinitely. Here, we
Grégory Eot-Houllier et al.
Nature communications, 9(1), 1888-1888 (2018-05-16)
Sustained spindle tension applied to sister centromeres during mitosis eventually leads to uncoordinated loss of sister chromatid cohesion, a phenomenon known as "cohesion fatigue." We report that Aurora A-dependent phosphorylation of serine 7 of the centromere histone variant CENP-A (p-CENP-AS7)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico