Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU097671

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAAGGCATTTGTGGGAAGAAACACTCTGAGCAAGTCCCAGATATACTACAACTCAATGCAATCTTTAACATGTTGAATACCAAGAACTGCCCAAGTTTGAAGGACAAACCGAAGGTGATCATCATCCAGGCCTGCCGTGGTGACAGCCCTGGTGTGGTGTGGTTTAAAGATTCAGTAGGAGTTTCTGGAAACCTATCTTTACCAACTACAGAAGAGTTTGAGGATGATGCTATTAAGAAAGCCCACATAGAGAAGGATTTTATCGCTTTCTGCTCTTCCACACC

Ensembl | nº de acceso humano

ENSG00000137752

Nº de acceso NCBI

NM_033295

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CASP1(834) , CASP1(834)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Weigang Zhang et al.
The Journal of pathology, 241(3), 392-404 (2016-11-20)
Psoriasis is an autoimmune skin disease, in which keratinocytes play a crucial pathogenic role. High-mobility group protein B1 (HMGB1) is an inflammatory factor that can be released from keratinocyte nuclei in psoriatic lesions. We aimed to investigate the proinflammatory effect
Vahid Mirshafiee et al.
ACS nano, 12(4), 3836-3852 (2018-03-16)
The liver and the mononuclear phagocyte system are a frequent target for engineered nanomaterials, either as a result of particle uptake and spread from primary exposure sites or systemic administration of therapeutic and imaging nanoparticles. In this study, we performed
Xiang Wang et al.
Small (Weinheim an der Bergstrasse, Germany), 16(21), e2000528-e2000528 (2020-04-28)
The mononuclear phagocyte system in the liver is a frequent target for nanoparticles (NPs). A toxicological profiling of metal-based NPs is performed in Kupffer cell (KC) and hepatocyte cell lines. Sixteen NPs are provided by the Nanomaterial Health Implications Research
Tianhao Huang et al.
Cell death & disease, 8(4), e2726-e2726 (2017-04-07)
Non-small-cell lung cancer (NSCLC) is one of the leading causes of cancer-related death worldwide. Although epigenetic deregulation is known to be important for tumor progression, the molecular mechanisms in NSCLC remain unclear. Here, we found that G9A (known as EHMT2)
Jason-Alexander Hörauf et al.
International journal of molecular sciences, 21(9) (2020-05-06)
This paper discusses how the assembly of pro-caspase-1 and apoptosis-associated speck-like protein containing a caspase-recruitment domain (ASC) in macromolecular protein complexes, inflammasomes, activates caspase-1. The present study investigates the molecular mechanisms of inflammasome activation in HepG2 cells and examines how
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico