Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU095101

Sigma-Aldrich

MISSION® esiRNA

targeting human NRG1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACCATCACCCTCAGCAGTTCAGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGGATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTTAAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAACAGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAAGATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAA

Ensembl | nº de acceso humano

ENSG00000157168

Nº de acceso NCBI

NM_013957

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NRG1(3084) , NRG1(3084)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Youya Wang et al.
Journal of thoracic disease, 10(6), 3166-3179 (2018-08-03)
Neuregulin1 (NRG1) is critical signaling protein that mediates the activation of downstream signaling pathways associated with malignancies. Multiple gene fusions related to NRG1 have been found in lung cancer. However, the underlying role NRG1 in lung cancer is yet unclear.
K Yonesaka et al.
Oncogene, 35(7), 878-886 (2015-05-12)
Human epidermal growth factor receptor (HER) 3 is aberrantly overexpressed and correlates with poor prognosis in non-small cell lung cancer (NSCLC). Patritumab is a monoclonal antibody against HER3 that has shown promising results in early-phase clinical trials, but an optimal
Alessandra Bolino et al.
EMBO molecular medicine, 8(12), 1438-1454 (2016-11-02)
Charcot-Marie-Tooth (CMT) neuropathies are highly heterogeneous disorders caused by mutations in more than 70 genes, with no available treatment. Thus, it is difficult to envisage a single suitable treatment for all pathogenetic mechanisms. Axonal Neuregulin 1 (Nrg1) type III drives

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico