Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU094491

Sigma-Aldrich

MISSION® esiRNA

targeting human NPHS1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TATTCCCGAGGTTTCACAGGTGAAGATGAGGATATGGCCTTCCCTGGGCACTTGTATGATGAGGTAGAAAGAACGTACCCCCCGTCTGGAGCCTGGGGACCCCTCTACGATGAAGTGCAGATGGGACCCTGGGACCTCCACTGGCCTGAAGACACATATCAGGATCCAAGAGGAATCTATGACCAGGTGGCCGGAGACTTGGACACTCTGGAACCCGATTCTCTGCCCTTCGAGCTGAGGGGACATCTGGTGTAAGAGCCCTCTCAACCCCATTGTCCTGCACCTGCAGGAATTTACACTCCACTGGTCTCTCTCATTACAGCCTGGGCCGAGCTGGTTAGGTGAGCTCCATAAAACCCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hossein Tezval et al.
BMC cancer, 13, 199-199 (2013-04-24)
Significance of Urocortin (Ucn or UcnI), Ucn2, Ucn3 and their receptors, Corticotropin Releasing Factor Receptor 1 and 2 (CRFR1 and CRFR2), and the binding protein, Corticotropin-Releasing Hormone-Binding Protein (CRHBP) in oncology is growing rapidly. The objective of our study was
Jiyoun Lee et al.
Scientific reports, 7(1), 12346-12346 (2017-09-29)
Hypertrophy is a prominent feature of damaged podocytes in diabetic kidney disease (DKD). mTORC1 hyperactivation leads to podocyte hypertrophy, but the detailed mechanism of how mTORC1 activation occurs under pathological conditions is not completely known. Moreover, reduced nephrin tyrosine phosphorylation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico