Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU093841

Sigma-Aldrich

MISSION® esiRNA

targeting human RORC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGGAAGTCCATGTGGGAGATGTGGGAACGGTGTGCCCACCACCTCACCGAGGCCATTCAGTACGTGGTGGAGTTCGCCAAGAGGCTCTCAGGCTTTATGGAGCTCTGCCAGAATGACCAGATTGTGCTTCTCAAAGCAGGAGCAATGGAAGTGGTGCTGGTTAGGATGTGCCGGGCCTACAATGCTGACAACCGCACGGTCTTTTTTGAAGGCAAATACGGTGGCATGGAGCTGTTCCGAGCCTTGGGCTGCAGCGAGCTCATCAGCTCCATCTTTGACTTCTCCCACTCCCTAAGTGCCTTGCACTTTTCCGAGGATGAGATTGCCCTCTACACAGCCCTTGTTCTCATCAATGCCCATCGGCCAGGGCTCCAAGAGAAAAGGAAAGTAGAACAGCTGCAGTACAATCTGGAGCTGGCCTT

Ensembl | nº de acceso humano

ENSG00000143365

Nº de acceso NCBI

NM_001001523

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RORC(6097) , RORC(6097)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hong Zhang et al.
International journal of molecular sciences, 19(4) (2018-04-05)
20(S)-Protopanaxadiol (PPD) is one of the major active metabolites of ginseng. It has been reported that 20(S)-PPD shows a broad spectrum of antitumor effects. Our research study aims were to investigate whether apoptosis of human breast cancer MCF-7 cells could
Peng Wang et al.
Neuroscience letters, 676, 58-65 (2018-04-02)
Ischemic postconditioning (IPostC) protects against stroke, but few have studied the pathophysiological mechanisms of its long-term protective effects. Here, we investigated whether the mTOR pathway is involved in the long-term protective effects of IPostC. Stroke was induced in rats by
Ziwei Huang et al.
Acta biochimica et biophysica Sinica, 49(8), 689-695 (2017-07-02)
Numerous studies have shown that the intrinsic axonal regenerative capacity of neurons differs between the peripheral and central nervous systems (CNSs). However, the molecular mechanisms controlling intrinsic axonal regenerative capacity are unclear. A better understanding of these mechanisms should aid
Geyang Xu et al.
Molecular and cellular endocrinology, 416, 9-18 (2015-08-19)
Glucagon-like peptide (GLP-1), an intestinal incretin produced in L-cells and released in response to meal intake, functions to promote insulin secretion and to decrease plasma glucose. Ghrelin is an orexigenic hormone critical for glucose homeostasis. The molecular mechanism by which
Yun-Jeong Jeong et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 68, 218-225 (2014-03-29)
Bee venom is a natural compound produced by the honey bee (Apis mellifera), and has been reported as having the biological and pharmacological activities, including anti-bacterial, anti-viral and anti-inflammation. In the present study, the inhibitory effects of bee venom and
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico