Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU092971

Sigma-Aldrich

MISSION® esiRNA

targeting human CD151

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AACACGGAGCTCAAGGAGAACCTGAAGGACACCATGACCAAGCGCTACCACCAGCCGGGCCATGAGGCTGTGACCAGCGCTGTGGACCAGCTGCAGCAGGAGTTCCACTGCTGTGGCAGCAACAACTCACAGGACTGGCGAGACAGTGAGTGGATCCGCTCACAGGAGGCCGGTGGCCGTGTGGTCCCAGACAGCTGCTGCAAGACGGTGGTGGCTCTTTGTGGGCAGCGAGACCATGCCTCCAACATCTACAAGGTGGAGGGCGGCTGCATCACCAAGTTGGAGACCTTCATCCAGGAGCACCTGAGGGTCATTGGGGCTGTGGGGATCGGCATTGCCTGTGTGCAGGTCTTTGGCATGATCTTCACGTGCTGCCTGTAC

Ensembl | nº de acceso humano

ENSG00000177697

Nº de acceso NCBI

NM_004357

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CD151(977) , CD151(977)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Laura A Fast et al.
International journal of molecular sciences, 19(10) (2018-10-04)
Tetraspanins are suggested to regulate the composition of cell membrane components and control intracellular transport, which leaves them vulnerable to utilization by pathogens such as human papillomaviruses (HPV) and cytomegaloviruses (HCMV) to facilitate host cell entry and subsequent infection. In
Yongkang Qiao et al.
The Journal of allergy and clinical immunology, 139(1), 82-92 (2016-05-29)
Airway smooth muscle (ASM) contraction underpins airway constriction; however, underlying mechanisms for airway hyperresponsiveness (AHR) remain incompletely defined. CD151, a 4-transmembrane glycoprotein that associates with laminin-binding integrins, is highly expressed in the human lung. The role of CD151 in ASM
Yongkang Qiao et al.
The Journal of allergy and clinical immunology, 141(5), 1799-1817 (2017-12-24)
Despite advances in our understanding of the mechanisms of influenza A virus (IAV) infection, the crucial virus-host interactions during the viral replication cycle still remain incomplete. Tetraspanin CD151 is highly expressed in the human respiratory tract, but its pathological role in
Soonyean Hwang et al.
Cellular and molecular life sciences : CMLS, 76(8), 1595-1604 (2019-02-20)
Tetraspanin protein CD151 has typically been studied as binding partner and functional regulator of laminin-binding integrins. However, we show here that CD151 supports anti-cancer drug resistance independent of integrins. CD151 ablation sensitized multiple tumor cell types to several anti-cancer drugs
Jérôme Finke et al.
Scientific reports, 10(1), 5356-5356 (2020-03-27)
During cell invasion, human papillomaviruses use large CD151 patches on the cell surface. Here, we studied whether these patches are defined architectures with features for virus binding and/or internalization. Super-resolution microscopy reveals that the patches are assemblies of closely associated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico