Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU092681

Sigma-Aldrich

MISSION® esiRNA

targeting human ADK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGTACAAGGGTATGGTAATGCTTGTAGAATCTTTATTATCTCAACAATCTAAAAAATGATGTTTATTTCCATAGTTTGATAGTGCCACTTAAATGCCAATTAAACAAGAATATAACATTTCAATAGAAATTTTTATTTCATTTTCAATTACTTTGTAAATTCGTGTGTATTTAGTACACTGATTTGTTTTTTTACATTTCTGCTTTGAATGCAGATGCAATTTAATATAATAGATTTTTTAATGAATTAATCTTAACATAGTAATCTTTAGCTTTTTATACAAATATATTTAATTTAGGAGTATATGTGTGTCTATACACACACATACATAAATATACCACATATACACCTGATAGTCAAATAAGGTACAGAAATTTTATCTTGTCAATTATGCCAAATAATCTCTTTAATGTGCACTCAAACA

Ensembl | nº de acceso humano

ENSG00000156110

Nº de acceso NCBI

NM_001123

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ADK(132) , ADK(132)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei Jin et al.
Journal of molecular histology, 47(3), 259-271 (2016-03-18)
Adenosine kinase (ADK) plays a pivotal role in regulating brain function by regulating adenosine level, and ADK inhibition protects against neuronal damage in cerebral ischemia and epilepsy; however, the effects of ADK in traumatic brain injury (TBI) have not been
Iwona Pelikant-Malecka et al.
The international journal of biochemistry & cell biology, 88, 31-43 (2017-03-23)
4-pirydone-3-carboxamide-1β-d-ribonucleoside (4PYR) is an endogenous nucleoside that could be converted to triphosphates, diphosphates, monophosphates and an analogue of NAD - 4PYRAD. Elevated level of these compounds have been reported in chronic renal failure, cancer and active HIV infection. However, little
Alexander J Valvezan et al.
JCI insight, 5(7) (2020-04-10)
Recent studies in distinct preclinical tumor models have established the nucleotide synthesis enzyme inosine-5'-monophosphate dehydrogenase (IMPDH) as a viable target for antitumor therapy. IMPDH inhibitors have been used clinically for decades as safe and effective immunosuppressants. However, the potential to
Tal Israeli et al.
Journal of cell science, 131(15) (2018-07-14)
AMPK-mTORC1 signaling senses nutrient availability, thereby regulating autophagy. Surprisingly, we found that, in β-cells, the AMPK activator 5-amino-4-imidazolecarboxamide ribofuranoside (AICAR) inhibited, rather than stimulated, autophagy. AICAR is an intermediate in the generation of inosine monophosphate, with subsequent conversion to other

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico