Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU092281

Sigma-Aldrich

MISSION® esiRNA

targeting human VPS13A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTCACTGAAGATCCAAGGGTATTTAAAGTAACATATGAAAGTGAGAAAGCAGAGTTAGCAGAGCAAGAAATTGCAGTGGCATTACAAGATGTTGGAATTTCTCTTGTCAACAATTACACGAAGCAAGAAGTAGCCTATATAGGCATTACAAGTTCTGATGTGGTTTGGGAAACAAAGCCCAAGAAGAAGGCAAGATGGAAGCCAATGAGTGTAAAGCACACTGAGAAGTTAGAGAGAGAATTTAAGGAATATACTGAATCTTCTCCTTCAGAAGATAAGGTTATTCAGTTGGACACTAATGTTCCGGTTCGCCTAACCCCTACTGGTCATAACATGAAAATTCTGCAGCCGCATGTAATAGCTCTACGAAGAAATTATCTTCCAGCATTAAAAGTGGAATATAACACATCTGCACATCAATCATC

Ensembl | nº de acceso humano

ENSG00000197969

Nº de acceso NCBI

NM_033305

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... VPS13A(23230) , VPS13A(23230)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Willi Yu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(5), 1141-1152 (2016-12-14)
Chorein, a protein encoded by VPS13A (vacuolar protein sorting-associated protein 13A), is defective in chorea acanthocytosis, a rare disease characterized by acanthocytosis of red blood cells and neuronal cell death with progressive hyperkinetic movement disorder, cognitive dysfunction, behavioral abnormalities and
Sandra Muñoz-Braceras et al.
Disease models & mechanisms, 12(2) (2019-02-03)
Members of the VPS13 family are associated with various human diseases. In particular, the loss of function of VPS13A leads to chorea-acanthocytosis (ChAc), a rare neurodegenerative disease without available curative treatments. Autophagy has been considered a promising therapeutic target because
Sabina Honisch et al.
Oncotarget, 6(12), 10309-10319 (2015-04-15)
Chorein encoded by VPS13A (vacuolar protein sorting-associated protein 13A) is defective in chorea-acanthocytosis. Chorein fosters neuronal cell survival, cortical actin polymerization and cell stiffness. In view of its anti-apoptotic effect in neurons, we explored whether chorein is expressed in cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico