Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU092071

Sigma-Aldrich

MISSION® esiRNA

targeting human FTO

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGAAGATTGGCCTCTTTCCTTTCTCTAAGACAAACCTAAGTAAAAGCCTGAGCTTTGAGTCCTATGCTCAGCACACGGGAAGGAGATGTTAATAATTAAAATAAAGTTGATATCCTGTCTTTAGGGAGTTCCCTTGATCTCTTGAAAGAGACACAGCCCCATTTACATTATTTCGTGGATTTCACCAGCATAGTATAGTTTTTTTCTGTAAGTCCCTCATTCTTATGTAATAACAGGTGGAACTGAGGTTTGAAGAACCTCAGTGGCCCATCCTGATGACATTGGAGACTCAAAGAGACAAGAGAGAGTAGGGTTTAAAACCTGAGCTTTAAGACTCCCACTAGCTTCGTGTCCTTTGGCATGTTAACGTGCCTCAGTTTCCTCATCTGTATAATGGGGATATATGAAAGGCACCAGTCCTAAGG

Ensembl | nº de acceso humano

ENSG00000140718

Nº de acceso NCBI

NM_001080432

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FTO(79068) , FTO(79068)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dong Xu et al.
Oncology reports, 38(4), 2285-2292 (2017-08-30)
Fat mass and obesity associated (FTO) is a protein-coding gene. FTO gene is an obesity related gene, also known as the obesity gene. It has been reported previously that FTO is associated with a variety of malignant cancers, such as
Ruifan Wu et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1862(8), 796-806 (2019-07-12)
N6-methyladenosine (m6A), the most abundant internal mRNA modification in eukaryotes, plays a vital role in regulating adipogenesis. However, its underlying mechanism remains largely unknown. Here, we reveal that deletion of m6A demethylase FTO in porcine and mouse preadipocytes inhibits adipogenesis
Ziqi Ye et al.
Oncology letters, 20(2), 1409-1417 (2020-07-30)
Liver cancer is the fourth leading cause of cancer-associated mortality worldwide. Statistics indicate that the incidence of liver cancer has been increasing and that its prognosis remains poor. Fat mass and obesity-associated protein (FTO) is a demethylase that is involved
Chenyue Ding et al.
Journal of cellular physiology, 233(9), 7055-7066 (2018-02-01)
The N6-methyladenosine (m6A) modification plays a central role in epigenetic regulation of the mammalian transcriptome. m6A can be demethylated by the fat mass- and obesity-associated (FTO) protein and the α-ketoglutarate-dependent dioxygenase alkB homolog 5 (ALKBH5) protein. Much less is known
Bo-Jhih Guan et al.
Molecular cell, 68(5), 885-900 (2017-12-09)
The integrated stress response (ISR) is a homeostatic mechanism induced by endoplasmic reticulum (ER) stress. In acute/transient ER stress, decreased global protein synthesis and increased uORF mRNA translation are followed by normalization of protein synthesis. Here, we report a dramatically

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico