Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU091861

Sigma-Aldrich

MISSION® esiRNA

targeting human ENG

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATGCAGATCTGGACCACTGGAGAATACTCCTTCAAGATCTTTCCAGAGAAAAACATTCGTGGCTTCAAGCTCCCAGACACACCTCAAGGCCTCCTGGGGGAGGCCCGGATGCTCAATGCCAGCATTGTGGCATCCTTCGTGGAGCTACCGCTGGCCAGCATTGTCTCACTTCATGCCTCCAGCTGCGGTGGTAGGCTGCAGACCTCACCCGCACCGATCCAGACCACTCCTCCCAAGGACACTTGTAGCCCGGAGCTGCTCATGTCCTTGATCCAGACAAAGTGTGCCGACGACGCCATGACCCTGGTACTAAAGAAAGAGCTTGTTGCGCATTTGAAGTGCACCATCACGGGCCTGACCTTCTGGGACCCCAGCTGTGAGGCAGAGGACAGGGGTGACAAGTTTGTCTTGCGCAGTGCTTACT

Ensembl | nº de acceso humano

ENSG00000106991

Nº de acceso NCBI

NM_000118

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ENG(2022) , ENG(2022)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shoumei Bai et al.
Cancers, 11(11) (2019-11-07)
: Most high-grade serous ovarian cancers (HGSCs) initiate from the fallopian tube epithelium and then metastasize to the ovary and throughout the abdomen. Genomic analyses suggest that most HGSCs seed the ovary prior to abdominal dissemination. Similarly, animal models support
Elisa Rossi et al.
Cellular and molecular life sciences : CMLS, 73(8), 1715-1739 (2015-12-10)
The circulatory system is walled off by different cell types, including vascular mural cells and podocytes. The interaction and interplay between endothelial cells (ECs) and mural cells, such as vascular smooth muscle cells or pericytes, play a pivotal role in
Krishnendu Pal et al.
Molecular cancer therapeutics, 13(10), 2264-2275 (2014-08-16)
Endoglin, a 180-kDa disulfide-linked homodimeric transmembrane receptor protein mostly expressed in tumor-associated endothelial cells, is an endogenous binding partner of GAIP-interacting protein, C terminus (GIPC). Endoglin functions as a coreceptor of TβRII that binds TGFβ and is important for vascular
Priyanka Singh et al.
Cancer research, 78(11), 2978-2989 (2018-03-15)
Inhibin is a heterodimeric TGFβ family ligand that is expressed in many cancers and is a selective biomarker for ovarian cancers; however, its tumor-specific functions remain unknown. Here, we demonstrate that the α subunit of inhibin (INHA), which is critical
Caixia Yuan et al.
Experimental and therapeutic medicine, 17(4), 2547-2556 (2019-03-25)
Bone morphogenetic protein (BMP) expression has been observed in the uterus in previous studies. However, the influence of BMP7 on blastocyst implantation remains unclear. Blastocysts first act on luminal endometrial epithelial cells during implantation. The purpose of the present study
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico