Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU091091

Sigma-Aldrich

MISSION® esiRNA

targeting human WNT2B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCGTGCACTCTCAGATTTCCGCCGCACAGGTGATTACCTGCGGCGACGCTATGATGGGGCTGTGCAGGTGATGGCCACCCAAGATGGTGCCAACTTCACCGCAGCCCGCCAAGGCTATCGCCGTGCCACCCGGACTGATCTTGTCTACTTTGACAACTCTCCAGATTACTGTGTCTTGGACAAGGCTGCAGGTTCCCTAGGCACTGCAGGCCGTGTCTGCAGCAAGACATCAAAAGGAACAGACGGTTGTGAAATCATGTGCTGTGGCCGAGGGTACGACACAACTCGAGTCACCCGTGTTACCCAGTGTGAGTGCAAATTCCACTGGTGCTGTGCTGTACGGTGCAAGGAATGCAGAAATACTGTGGACGTCCATACTTGCAAAGCCCCCAAGAAGGCAGAGTGGCTGGACCAAACCTGAACACA

Ensembl | nº de acceso humano

ENSG00000134245

Nº de acceso NCBI

NM_024494

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... WNT2B(7482) , WNT2B(7482)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chao Liu et al.
Cancer cell international, 17, 2-2 (2017-01-06)
Nasopharyngeal carcinoma (NPC) is a malignant epithelial carcinoma of the head and neck with strong ability of invasion and metastasis. Our previous study indicated that miR-324-3p, as a tumor-suppressive factor, could regulate radioresistance of NPC cells by targeting Quantitative real
Bin Wang et al.
Molecular medicine reports, 18(3), 2753-2761 (2018-07-18)
MicroRNAs (miRNAs/miRs) serve important roles in regulating malignant phenotype in numerous cancers, such as non-small cell lung cancer (NSCLC); however, the role and function of miR-577 in NSCLC remains unknown. In the present study, miR-577 expression levels were observed to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico