Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU090991

Sigma-Aldrich

MISSION® esiRNA

targeting human PAX6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTGCAAAGAAATAGAACATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCATTATCCAGATGTGTTTGCCCGAGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATGGTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGAAGACAGGCCAGCAACACACCTAGTCATATTCCTATCAGCAGTAGTTTCAGCACCAGTGTCTACCAACCAATTCCACAACCCACCACACCGGTTTCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCTACAGCGCTCTGCCGCCTATGCCCAGCTTCACCATGGCAAATA

Ensembl | nº de acceso humano

ENSG00000007372

Nº de acceso NCBI

NM_001604

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PAX6(5080) , PAX6(5080)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hassan Akrami et al.
Journal of ophthalmic & vision research, 4(3), 134-141 (2009-07-01)
To establish human retinal pigment epithelial (RPE) cell culture as a source for cell replacement therapy in ocular diseases. Human cadaver globes were used to isolate RPE cells. Each globe was cut into several pieces of a few millimeters in
Zhe Qian et al.
Respiratory research, 19(1), 262-262 (2018-12-31)
This study investigated the function of SMAD3 (SMAD family member 3) in regulating PAX6 (paired box 6) in non-small cell lung cancer. First, qRT-PCR was employed to detect SMAD3 expression in cancer tissues along with normal tissues and four cell lines
Akira Ooki et al.
Oncogene, 37(45), 5967-5981 (2018-07-08)
It remains unclear whether PAX6 acts as a crucial transcription factor for lung cancer stem cell (CSC) traits. We demonstrate that PAX6 acts as an oncogene responsible for induction of cancer stemness properties in lung adenocarcinoma (LUAD). Mechanistically, PAX6 promotes
Siri Forsdahl et al.
PloS one, 9(7), e102559-e102559 (2014-07-17)
Pax6 is a transcription factor important for early embryo development. It is expressed in several cancer cell lines and tumors. In glioblastoma, PAX6 has been shown to function as a tumor suppressor. Dickkopf 3 (Dkk3) is well established as a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico