Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU090641

Sigma-Aldrich

MISSION® esiRNA

targeting human RASAL2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGACTGGTCGCCAATTTGTAGAAAAGTGGTATCCAGTGAGTACACCTACACCCAACAAAGGAAAGACAGGAGGACCTTCTATTCGGATTAAATCACGTTTCCAAACTATCACCATTCTGCCTATGGAGCAATACAAAGAATTTGCAGAATTTGTCACCAGCAACTACACCATGCTGTGTTCTGTCCTTGAGCCAGTAATTAGTGTGAGAAATAAAGAGGAGTTGGCTTGTGCCTTAGTGCACATTCTTCAAAGTACTGGCAGAGCCAAGGATTTTCTGACTGACTTGGTGATGTCTGAGGTGGATCGTTGTGGAGAGCATGATGTCTTGATCTTCAGAGAGAACACTATTGCCACCAAATCCATTGAGGAATACCTCAAGTTGGTGGGACAACAGTATCTTCATGACGCACTGGGGGAGTTTATCAA

Ensembl | nº de acceso humano

ENSG00000075391

Nº de acceso NCBI

NM_004841

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RASAL2(9462) , RASAL2(9462)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ke Hui et al.
Cell death & disease, 8(2), e2600-e2600 (2017-02-10)
Muscle-invasive or metastatic bladder cancer (BCa) is associated with a very poor prognosis, and the underlying mechanism remains poorly understood. In this study, we demonstrate RASAL2, a RAS GTPase-activating protein (RAS GAP), acts as a tumor suppressor in BCa. First
Libo Yin et al.
Molecular therapy oncolytics, 14, 74-81 (2019-05-03)
Pancreatic ductal adenocarcinoma (PDA) is one of the most lethal tumors, with poor therapeutic options in the advanced state. The broccoli-derived anti-inflammatory agent sulforaphane was shown to inhibit the progression of pancreatic cancer and other tumor entities. We examined the
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico