Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU090071

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC9 (3)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGTTCTCCAGGCTCTGGTCCCAGTTCACCAAACAATGGGCCAACTGGAAGTGTTACTGAAAATGAGACTTCGGTTTTGCCCCCTACCCCTCATGCCGAGCAAATGGTTTCACAGCAACGCATTCTAATTCATGAAGATTCCATGAACCTGCTAAGTCTTTATACCTCTCCTTCTTTGCCCAACATTACCTTGGGGCTTCCCGCAGTGCCATCCCAGCTCAATGCTTCGAATTCACTCAAAGAAAAGCAGAAGTGTGAGACGCAGACGCTTAGGCAAGGTGTTCCTCTGCCTGGGCAGTATGGAGGCAGCATCCCGGCATCTTCCAGCCACCCTCATGTTACTTTAGAGGGAAAGCCACCCAACAGCAGCCACCAGGCTCTCCTGCAGCATTTATTATTGAAAGAACAAATGCGACAGCAAAAGCTT

Ensembl | nº de acceso humano

ENSG00000048052

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HDAC9(9734) , HDAC9(9734)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
BZS
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhiqiang Yu et al.
Oncology letters, 17(3), 3296-3304 (2019-03-15)
Gastric cancer (GC) is a common life-threatening cancer type worldwide, with an increasing prevalence and a high rate of mortality. Due to limitations in clinical treatment, surgery has become the most efficient strategy for the treatment of GC. It is
Yue Yang et al.
The Journal of nutritional biochemistry, 40, 172-177 (2016-12-05)
Activation of hepatic stellate cells (HSCs) is critical for liver fibrosis development. Previously, we showed that astaxanthin (ASTX), a xanthophyll carotenoid, has antifibrogenic effects in LX-2 cells, a human HSC cell line. We sought to determine the effect of ASTX
Gaoyan Wang et al.
Molecular carcinogenesis, 59(12), 1392-1408 (2020-10-21)
Countless evidence suggests that long noncoding RNAs (lncRNAs) are involved in human malignant cancers, including esophageal squamous cell carcinoma (ESCC), although their exact function remains unclear. In the present study, we aimed to investigate the roles and molecular mechanisms of the
Changliang Shan et al.
Cell death & disease, 10(7), 525-525 (2019-07-10)
4-hydroxyphenylpyruvate dioxygenase (HPD) is an important modifier of tyrosine metabolism. However, the precise contribution of HPD to cancer metabolism and tumorigenesis remains unclear. In this study, we found that HPD was highly expressed in lung cancer and its higher expression
Dong-Qin Chen et al.
Therapeutic advances in medical oncology, 10, 1758835918783132-1758835918783132 (2018-07-24)
Treatment of metastatic castration-resistant prostate cancer (mCRPC) with docetaxel often fails due to the emergence of chemoresistance. Thus, restoring chemosensitivity to docetaxel-based therapies remains a challenge in mCRPC treatment. microRNA (miR)-451 expression was measured in docetaxel-treated prostate cancer cells and
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico