Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU088931

Sigma-Aldrich

MISSION® esiRNA

targeting human MSN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCACCTGGCTGAAACTCAATAAGAAGGTGACTGCCCAGGATGTGCGGAAGGAAAGCCCCCTGCTCTTTAAGTTCCGTGCCAAGTTCTACCCTGAGGATGTGTCCGAGGAATTGATTCAGGACATCACTCAGCGCCTGTTCTTTCTGCAAGTGAAAGAGGGCATTCTCAATGATGATATTTACTGCCCGCCTGAGACCGCTGTGCTGCTGGCCTCGTATGCTGTCCAGTCTAAGTATGGCGACTTCAATAAGGAAGTGCATAAGTCTGGCTACCTGGCCGGAGACAAGTTGCTCCCGCAGAGAGTCCTGGAACAGCACAAACTCAACAAGGACCAGTGGGAGGAGCGGATCCAGGTGTGGCATGAGGAACACCGTGGCATGCTCAGGGAGGATGCTGTCCT

Ensembl | nº de acceso humano

ENSG00000147065

Nº de acceso NCBI

NM_002444

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MSN(4478) , MSN(4478)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

12 - Non Combustible Liquids

Clase de riesgo para el agua (WGK)

WGK 1

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
EZR
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shubing Lan et al.
Biochemical and biophysical research communications, 524(4), 861-868 (2020-02-15)
Moesin has been proved to be implicated in invasiveness and metastasis in many other cancers, but unclear in HCC. Thus, this study was performed to investigate the clinical significance of moesin and its biological functions in HCC. The results showed
Bernard Degryse et al.
The international journal of biochemistry & cell biology, 88, 14-22 (2017-05-06)
The glycosyl-phosphatidyl-inositol (GPI)-anchored urokinase receptor (uPAR) has no intracellular domain, but nevertheless initiates signalling through proximal interactions with other membrane receptors including integrins. The relationships between uPAR and ezrin/radixin/moesin (ERM) proteins, moesin and merlin have never been explored. Moesin and
Yao-yin Li et al.
Oral oncology, 51(10), 935-943 (2015-07-22)
The present study aimed to clarify the role of Moesin in oral squamous cell carcinoma (OSCC) progression, especially in regulation of cell motility. Immunohistochemistry and western blotting were used to investigate the expression of Moesin, E-cadherin, p120-catenin and MT1-MMP in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico