Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU088381

Sigma-Aldrich

MISSION® esiRNA

targeting human EGLN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCTGGCGCTCGAGTACATCGTGCCGTGCATGAACAAGCACGGCATCTGTGTGGTGGACGACTTCCTCGGCAAGGAGACCGGACAGCAGATCGGCGACGAGGTGCGCGCCCTGCACGACACCGGGAAGTTCACGGACGGGCAGCTGGTCAGCCAGAAGAGTGACTCGTCCAAGGACATCCGAGGCGATAAGATCACCTGGATCGAGGGCAAGGAGCCCGGCTGCGAAACCATTGGGCTGCTCATGAGCAGCATGGACGACCTGATACGCCACTGTAACGGGAAGCTGGGCAGCTACAAAATCAATGGCCGGACGAAAGCCATGGTTGCTTGTTATCCGGGCAATGGAACGGGTTATGTACGTCATGTTGATAATCCAAATGGAGATGGAAGATGTGTGAC

Ensembl | nº de acceso humano

ENSG00000135766

Nº de acceso NCBI

NM_022051

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... EGLN1(54583) , EGLN1(54583)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
GZT
QCS
MBS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Junping Hu et al.
Scientific reports, 7(1), 15878-15878 (2017-11-22)
Proteinuria is closely associated with the progression of chronic kidney diseases (CKD) by producing renal tubulointerstitial fibrosis. Over-activation of hypoxia inducible factor (HIF)-1α has been implicated in the progression of CKD. The present study tested the hypothesis that HIF-1α mediates
Hyo Jeong Yong et al.
Oncotarget, 8(41), 69833-69846 (2017-10-21)
Hypoxia-induced interleukin-32β (IL-32β) shifts the metabolic program to the enhanced glycolytic pathway. In the present study, the underlying mechanism by which hypoxia-induced IL-32β stability is regulated was investigated in ovarian cancer cells. IL-32β expression increased under hypoxic conditions in ovarian
Kai Zhu et al.
International journal of nanomedicine, 9, 5203-5215 (2014-11-28)
Mesenchymal stem cell (MSC) transplantation has attracted much attention in myocardial infarction therapy. One of the limitations is the poor survival of grafted cells in the ischemic microenvironment. Small interfering RNA-mediated prolyl hydroxylase domain protein 2 (PHD2) silencing in MSCs

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico