Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU086801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGGAACACCTGATTTTCATACAATCCCAGCATTTTGTTTGACTCCACCTTACAGTCCTTCTGACTTTGAACCCTCTCAAGTGTCAAATCTGATGGCACCAGCGCCATCTACTGTACACTTCAAGTCACTCTCAGATACTGCCAAACCTCACATTGCCGCACCTTTCAAAGAGGAAGAAAAGAGCCCAGTATCTGCCCCCAAACTCCCCAAAGCTCAGGCAACAAGTGTGATTCGTCATACAGCTGATGCCCAGCTATGTAACCACCAGACCTGCCCAATGAAAGCAGCCAGCATCCTCAACTATCAGAACAATTCTTTTAGAAGAAGAACCCACCTAAATGTTGAGGCTGCAAGAAAGAACATACCATGTGCCGCTGTGTCACCAAACAGATCCAAATGTGAGAGAAACACAGTGGCAGATGTTGATGAGA

Ensembl | nº de acceso humano

ENSG00000155090

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KLF10(7071) , KLF10(7071)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Abigail A Delaney et al.
Biology of reproduction, 95(3), 62-62 (2016-08-05)
Endometriosis is a highly prevalent, chronic, heterogeneous, fibro-inflammatory disease that remains recalcitrant to conventional therapy. We previously showed that loss of KLF11, a transcription factor implicated in uterine disease, results in progression of endometriosis. Despite extensive homology, co-expression, and human
Vivek Kumar Mishra et al.
Cancer research, 77(9), 2387-2400 (2017-03-03)
TGFβ-SMAD signaling exerts a contextual effect that suppresses malignant growth early in epithelial tumorigenesis but promotes metastasis at later stages. Longstanding challenges in resolving this functional dichotomy may uncover new strategies to treat advanced carcinomas. The Krüppel-like transcription factor, KLF10
Malayannan Subramaniam et al.
Journal of cellular physiology, 233(4), 3540-3551 (2017-10-19)
TIEG knockout (KO) mice exhibit a female-specific osteopenic phenotype and altered expression of TIEG in humans is associated with osteoporosis. Gene expression profiling studies identified sclerostin as one of the most highly up-regulated transcripts in the long bones of TIEG
Jong Min Lee et al.
Molecular therapy. Nucleic acids, 17, 310-322 (2019-07-10)
We investigated the functional role of miR-892b as a novel inhibitor of chondrocyte hypertrophy during TGF-β-mediated chondrogenesis of human mesenchymal stem cells (hMSCs). The expression of miR-892b during TGF-β-mediated chondrogenesis of hMSCs and the effects of miR-892b overexpression on chondrogenic
Chun-Liang Lin et al.
EMBO molecular medicine, 11(5) (2019-04-06)
Diabetic nephropathy is the leading cause of end-stage renal disease. Although dysfunction of podocytes, also termed glomerular visceral epithelial cells, is critically associated with diabetic nephropathy, the mechanism underlying podocyte dysfunction still remains obscure. Here, we identify that KDM6A, a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico