Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU085221

Sigma-Aldrich

MISSION® esiRNA

targeting human SHC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño


Seleccione un Tamaño

Cambiar Vistas

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATCTGCCCTAGCGCTCTCTTCCAGAAGATGCCCTCCAATCCTTTCCACCCTATTCCCTAACTCTCGGGACCTCGTTTGGGAGTGTTCTGTGGGCTTGGCCTTGTGTCAGAGCTGGGAGTAGCATGGACTCTGGGTTTCATATCCAGCTGAGTGAGAGGGTTTGAGTCAAAAGCCTGGGTGAGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yukun Zhang et al.
Aging, 12(3), 2049-2069 (2020-02-06)
Hepatic steatosis and oxidative stress are considered to be the sequential steps in the development of non-alcoholic fatty liver disease (NAFLD). We previously found that catalpol, an iridoid glucoside extracted from the root of Romania glutinosa L, protected against diabetes-induced
Zhecheng Wang et al.
Molecular therapy. Nucleic acids, 21, 751-763 (2020-08-12)
We previously found that inhibition of p66Shc confers protection against hepatic stellate cell (HSC) activation during liver fibrosis. However, the effect of p66Shc on HSC proliferation, as well as the mechanism by which p66Shc is modulated, remains unknown. Here, we
Hyo Jung Shin et al.
International journal of nanomedicine, 15, 2379-2390 (2020-04-21)
Osteoarthritis (OA) is the most common type of joint disease associated with cartilage breakdown. However, the role played by mitochondrial dysfunction in OA remains inadequately understood. Therefore, we investigated the role played by p66shc during oxidative damage and mitochondrial dysfunction

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico