Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU085201

Sigma-Aldrich

MISSION® esiRNA

targeting human NDRG1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTCGAGGCTAGAGGCATTTGGAACAACAAATCTACGTAGTTAACTTGAAGAAACCGATTTTTAAAGTTGGTGCATCTAGAAAGCTTTGAATGCAGAAGCAAACAAGCTTGATTTTTCTAGCATCCTCTTAATGTGCAGCAAAAGCAGGCGACAAAATCTCCTGGCTTTACAGACAAAAATATTTCAGCAAACGTTGGGCATCATGGTTTTTGAAGGCTTTAGTTCTGCTTTCTGCCTCTCCTCCACAGCCCCAACCTCCCACCCCTGATACATGAGCCAGTGATTATTCTTGTTCAGGGAGAAGATCATTTAGATTTGTTTTGCATTCCTTAGAATGGAGGGCAACATTCCACAGCTGCCCTGGCTGTGATGAGTGTCCTTGCAGGGGCCGGAGTAGGAGCACTGGGGTGGGGGTGGAATTGGGGTTACTCGA

Ensembl | nº de acceso humano

ENSG00000104419

Nº de acceso NCBI

NM_006096

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NDRG1(10397) , NDRG1(10397)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
WQS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gang Cen et al.
Oncology reports, 37(2), 1189-1195 (2017-01-12)
The N-myc downstream regulated gene 1 (NDRG1) is differently expressed in human malignancies according to the tumor type. We investigated the expression of NDRG1 in pancreatic cancer tissues and cell lines as well as how it affects tumor growth, invasion and
Aiwei Li et al.
Scientific reports, 9(1), 5166-5166 (2019-03-28)
N-myc downstream regulated gene 1 (NDRG1) is an intracellular protein involved in cell differentiation and was recently reported to exert various effects in several cancers. However, its expression and role in bladder cancer remain unclear. Our study enrolled 100 bladder
Nan Meng et al.
Molecular reproduction and development, 86(9), 1210-1223 (2019-07-25)
Embryo implantation is an essential step for a successful pregnancy, and any defect in this process can lead to a range of pregnancy pathologies. The objective of this study was to explore the role of N-myc downregulated gene 1 (NDRG1)
Christopher J Sevinsky et al.
Breast cancer research : BCR, 20(1), 55-55 (2018-06-15)
Altered lipid metabolism is an emerging hallmark of aggressive breast cancers. The N-myc downstream regulated gene (NDRG1) gene plays a critical role in peripheral nervous system myelination, as inactivating mutations cause severe demyelinating neuropathy. In breast cancer, elevated NDRG1 expression
Zhi-Yan Hu et al.
Biochimica et biophysica acta, 1852(9), 1876-1886 (2015-06-15)
N-myc downstream-regulated gene 1 (NDRG1) has been implicated in tumorigenesis and metastasis in different cancers. However, its role in nasopharyngeal carcinoma remains unknown. We found that NDRG1 expression level was high in nasopharyngeal cancer 5-8F cells but low in 5-8F-LN
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico