Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU084631

Sigma-Aldrich

MISSION® esiRNA

targeting human YTHDF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAGCGATAGCAACTCTCCTGGAAACGTCCAGCCTAATTCTGCCCCCAGCGTCGAATCCCACCCCGTCCTTGAAAAACTGAAGGCTGCTCACAGCTACAACCCGAAAGAGTTTGAGTGGAATCTGAAAAGCGGGCGTGTGTTCATCATCAAGAGCTACTCTGAGGACGACATCCACCGCTCCATTAAGTACTCCATCTGGTGTAGCACAGAGCACGGCAACAAGCGCCTGGACAGCGCCTTCCGCTGCATGAGCAGCAAGGGGCCCGTCTACCTGCTCTTCAGCGTCAATGGGAGTGGGCATTTTTGTGGGGTGGCCGAGATGAAGTCCCCCGTGGACTACGGCACCAGTGCCGGGGTCTGGTCTCAGGACAAGTGGAAGGGGAAGTTTGATGTCCAGTGGA

Ensembl | nº de acceso humano

ENSG00000149658

Nº de acceso NCBI

NM_017798

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... YTHDF1(54915) , YTHDF1(54915)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiang Li et al.
Frontiers in oncology, 10, 234-234 (2020-03-21)
Ammonium tetrathiomolybdate (ATTM) has been used in breast cancer therapy for copper chelation, as elevated copper promotes tumor growth. ATTM is also an identified H2S donor and endogenous H2S facilitates VitB12-induced S-adenosylmethionine (SAM) generation, which have been confirmed in m6A
Ye Fu et al.
Nature chemical biology, 16(9), 955-963 (2020-05-27)
Diverse RNAs and RNA-binding proteins form phase-separated, membraneless granules in cells under stress conditions. However, the role of the prevalent mRNA methylation, m6A, and its binding proteins in stress granule (SG) assembly remain unclear. Here, we show that m6A-modified mRNAs

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico