Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU084491

Sigma-Aldrich

MISSION® esiRNA

targeting human CHAF1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCTGAATCTTGTCCCAAAGGGGAAAGCCGATGACATGTCAGACGATCAGGGTACTTCTGTGCAAAGTAAAAGCCCCGATTTAGAGGCCTCTTTGGACACCTTGGAAAACAACTGTCATGTGGGTTCTGACATAGACTTTAGACCGAAACTTGTCAACGGGAAGGGTCCCTTAGATAACTTTTTAAGAAATAGAATCGAAACCAGTATTGGCCAGAGCACAGTCATCATTGATTTGACAGAGGACTCGAATGAGCAGCCAGACAGTCTTGTGGACCACAATAAACTAAATTCTGAAGCCTCTCCCTCCAGGGAGGCAATAAATGGCCAGCGAGAAGACACTGGGGATCAGCAGGGGTTGTTGAAGGCCATTCAGAACGACAAGTTGGCATTTCCTGGAGAGA

Ensembl | nº de acceso humano

ENSG00000167670

Nº de acceso NCBI

NM_005483

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CHAF1A(10036) , CHAF1A(10036)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Acciones bioquímicas o fisiológicas

CHAF1A (chromatin assembly factor 1 subunit A) is one of the subunits of CAF1 complex, a histone chaperone responsible for the positioning of histone H3 and H4 dimers into nucleosomes. CAF1 is needed for S-phase progression, heterochromatin formation and chromatin restoration after DNA repair. CAF1A is required for promoting protein and chromosome associations with nucleoli. It is required for cell proliferation and is upregulated in colon cancer and aggressive neuroblastoma.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
CLU
UAS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

A separable domain of the p150 subunit of human chromatin assembly factor-1 promotes protein and chromosome associations with nucleoli.
Smith CL, et. al.
Molecular Biology of the Cell, 25, 2866-2866 (2014)
The Chromatin Assembly Factor Complex 1 (CAF1) and 5-Azacytidine (5-AzaC) Affect Cell Motility in Src-transformed Human Epithelial Cells.
Endo A
The Journal of Biological Chemistry, 292, 172-172 (2017)
Regulation of oxidized base damage repair by chromatin assembly factor 1 subunit A.
Yang C
Nucleic Acids Research, 45, 739-739 (2017)
Corey L Smith et al.
Molecular biology of the cell, 25(18), 2866-2881 (2014-07-25)
Chromatin assembly factor-1 (CAF-1) is a three-subunit protein complex conserved throughout eukaryotes that deposits histones during DNA synthesis. Here we present a novel role for the human p150 subunit in regulating nucleolar macromolecular interactions. Acute depletion of p150 causes redistribution

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico