Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU083941

Sigma-Aldrich

MISSION® esiRNA

targeting human VEGFA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTCCGAAACCATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCA

Ensembl | nº de acceso humano

ENSG00000112715

Nº de acceso NCBI

NM_001025366

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... VEGFA(7422) , VEGF(7422)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhaohui Liu et al.
Molecular immunology, 106, 153-158 (2019-01-07)
MicroRNAs (miRNAs) play important roles in kidney development and maintenance of kidney physiological functions. MiR-377 has been reported to regulate inflammation in cardiac and cerebral ischemia. However, it remains unclear whether it has a similar function in renal ischemia/reperfusion (I/R).
So Yoon Ahn et al.
Experimental & molecular medicine, 50(4), 26-26 (2018-04-14)
We previously reported the role of vascular endothelial growth factor (VEGF) secreted by mesenchymal stem cells (MSCs) in protecting against neonatal hyperoxic lung injuries. Recently, the paracrine protective effect of MSCs was reported to be primarily mediated by extracellular vesicle
Alberto Ouro et al.
Experimental cell research, 361(2), 277-283 (2017-10-31)
The bioactive sphingolipid ceramide 1-phosphate (C1P) regulates cell division in a variety of cell types including macrophages. However, the mechanisms involved in this action are not completely understood. In the present work we show that C1P stimulates the release of
Huan Sun et al.
Journal of cellular physiology, 234(11), 20623-20633 (2019-04-21)
Myocardial ischemia is accompanied with hypoxia injury in myocardial cells. Long noncoding RNAs (lncRNA) CAMK2D-associated transcript 1 (C2dat1) C2dat1) has been linked with several ischemic diseases. However, the investigation regarding its role in myocardial ischemia is relatively rare. The aim
Jae Hyeop Lee et al.
Journal of controlled release : official journal of the Controlled Release Society, 263, 29-38 (2017-04-05)
RNA, one of the major biological macromolecules, has been considered as an attractive building material for bottom-up fabrication of nanostructures in the past few decades due to advancements in RNA biology, RNA chemistry and RNA nanotechnology. Most recently, an isothermal
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico