Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU083211

Sigma-Aldrich

MISSION® esiRNA

targeting human TLE1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCTCGTCAGTGCTTAGCTGTGACATCTCTGTGGATGATAAGTACATAGTCACTGGCTCGGGGGACAAGAAGGCTACAGTCTATGAAGTCATCTACTGAAAACATTATGTGGTTTAACGTTTATAGTTGAATTGGGCCAAAATGTTTCGAATTTATAGAAATAGAAAAGTTGTAACTTTAAAAGAGAAAAAAAATTACAAACACCTGTTTCCAAACCTTGACAGAAAACTACTTTGAGTCTACAAAGAGGAGGCGACAAGTCCATCAGCAGAAAGTCACCTGTCTACATAGACCAAATGGAGCACCAAGGCCAAGCGGACAGAGGGGCCATGGGTTGTAGGATTGAGGAACGGAATCTGCCGACTCACATGACAGCCCATTCTTTCTTTCTGGGTGATCTGGG

Ensembl | nº de acceso humano

ENSG00000196781

Nº de acceso NCBI

NM_005077

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TLE1(7088) , TLE1(7088)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei Chen et al.
Bioscience, biotechnology, and biochemistry, 84(6), 1176-1182 (2020-03-03)
Liver damage induced by ischemia/reperfusion (I/R) remains a primary issue in multiple hepatic surgeries. Innate immune-mediated inflammatory responses during the reperfusion stage aggravate the injury. Nevertheless, the detailed mechanism of hepatic I/R has not been fully clarified yet. Our research
Federica De Paoli et al.
FEBS letters, 590(1), 43-52 (2016-01-15)
Macrophages display heterogeneous phenotypes, including the classical M1 proinflammatory and the alternative M2 anti-inflammatory polarization states. The transducin-like enhancer of split-1 (TLE1) is a transcriptional corepressor whose functions in macrophages have not been studied yet. We report that TLE1 is
Xin Yao et al.
Oncotarget, 8(42), 72235-72249 (2017-10-27)
The Transducin-like enhancer of split 1 (TLE1) corepressor protein is overexpressed in human lung tumors and is a putative lung-specific oncogene. However, the molecular mechanism underlying its oncogenic function remains to be delineated. Here, we report an important role of
Xin Yao et al.
PloS one, 9(7), e101564-e101564 (2014-07-09)
The mitochondrial Bit1 (Bcl-2 inhibitor of transcription 1) protein is a part of an apoptotic pathway that is uniquely regulated by integrin-mediated attachment. As an anoikis effector, Bit1 is released into the cytoplasm following loss of cell attachment and induces

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico