Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU083111

Sigma-Aldrich

MISSION® esiRNA

targeting human CD86

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATGGCTCATGACCTGGAAATAAAATTTAGGACCAATACCTCCTCCAGATCAGATTCTTCTCTTAATTTCATAGATTGTGTTTTTTTTTTAAATAGACCTCTCAATTTCTGGAAAACTGCCTTTTATCTGCCCAGAATTCTAAGCTGGTGCCCCACTGAATTTTGTGTGTACCTGTGACTAAACAACTACCTCCTCAGTCTGGGTGGGACTTATGTATTTATGACCTTATAGTGTTAATATCTTGAAACATAGAGATCTATGTACTGTAATAGTGTGATTACTATGCTCTAGAGAAAAGTCTACCCCTGCTAAGGAGTTCTCATCCCTCTGTCAGGGTCAGTAAGGAAAACGGTGGCCTAGGGTACAGGCAACAATGAGCAGACCAACCTAAATTTGGGGAA

Ensembl | nº de acceso humano

ENSG00000114013

Nº de acceso NCBI

NM_175862

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CD86(942) , CD86(942)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Impacts of CD40- and CD86-Silenced Antigen-Specific B Cells on the Control of Allergies.
Motohiko Suzuki et al.
American journal of rhinology & allergy, 33(5), 513-523 (2019-05-09)
Emi Furusawa et al.
The Journal of investigative dermatology, 139(10), 2164-2173 (2019-04-13)
PD-L2 is a ligand for the immune checkpoint receptor PD-1; however, its regulatory function is unclear. We previously reported that silencing of CD86 in cutaneous dendritic cells by topical application of small interfering RNA (siRNA) inhibits the elicitation of contact
Naila Mebarek et al.
European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V, 92, 216-227 (2015-03-23)
Dendritic cells (DCs) are professional antigen-presenting cells that play a critical role in maintaining the balance between immunity and tolerance and, as such are a promising immunotherapy tool to induce immunity or to restore tolerance. The main challenge to harness

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico